Phytologia

PHYTOLOGIA

An international journal to expedite plant systematic
phytogeographical and ecological publication

www.phytologia.org

Vol. 91, No. 1, pp 1-188 April 2009

PHYTOLOGIA

(ISSN 00319430)
Phytologia, a journal for rapid publication in plant systematics,
phytogeography and vegetation ecology, is published three times a year.

Managing Editor Executive Editor
micro-Molecular, Phytochemical General systematics
and Multivariate Systematics and evolution
Robert P. Adams Billie L. Turner
Baylor University University of Texas at Austin
Baylor-Gruver Lab Austin, TX 78705
Gruver, TX 79040 billie@uts.cc.utexas.edu

Robert_ Adams@baylor.edu
Associate Editors

Nomenclature General Systematics
Guy Nesom A. Michael Powell
2925 Hartwood Drive Dept. of Biology
Fort Worth, TX 76109 Sul Ross State University
www.guynesom.com Alpine, TX, 79832
ampowell@sulross.edu
Macro-Molecular and Ethnobotany
Phylogenetic Systematics Martin Terry
Andrea E. Schwarzbach Dept. of Biology
Univ. of Texas at Brownsville Sul Ross State University
Dept. of Biol. Sciences Alpine, TX, 79832
Brownsville, TX, 78520 mterry@sulross.edu

andrea.schwarzbach@utb.edu

Secretary-Treasurer - Subscriptions
Robert P. Adams
Phytologia, Box 727, Gruver, TX 79040
Robert Adams@baylor.edu
Copyright 2008 Phytologia. Texensis Publishing, Gruver, TX

Phytologia (April 2009) 91(1) l

Phytologia

Contents

M. Woods and J. Key. The genus Rhynchosia (Fabaceae) in Alabama..

D. S. Seigler and J. E. Ebinger. New combinations in the genus J
Bemecmia (Pabaceac: (Mimosoideae)s.i10. «ils dees iis otled Sad deade Xs 26

R. P. Adams. The leaf essential oil of J. maritima R. P. Adams
compared with J. horizontalis, J. scopulorum and J. virginiana oils...31

R. P. Adams. Geographic variation and systematics of Juniperus
phoenicea from Madeira and the Canary Islands: Analyses of leaf
NAS oc dp at crate tid Mercier Oa aces nine nae aac pee 40

J. E. Averett. Schraderanthus, A new genus of Solanaceae............. 54

G. L. Nesom. Point of view: Authors' initials in scientific names with
RaDESEE URGHORICIOS ( 5, cic bicd th. Saei seine edb ace BEM cae Sta ie Sark ae A tg 62

G. L. Nesom. Maytenus phyllanthoides (Celastraceae) in Louisiana, ft
MAKEMOtes On taxonomy Of fhe SPECIES. 3/2. :...038.0..skeease~ ees scneoeewe! 64

J. R. Singhurst, D. J. Rosen and W. C. Holmes. Two new additions to
MRMRGEEE II SOA Of U ORAS 56 5 5st cian deneacbae acs sane sbaanwtneenteucees 69 «

J. R. Singhurst, K. M. Fleming, R. Loper, and W. C. Holmes. Romulea
rosa inidacéae)Adventive in Texas.cnei eee. -.k. eS A 13: 4

Cover Photos: Morus murrayana by Dayle E. Saar and Euthamia
caroliniana by Jason Singhurst. ee 0"

NICAI tAR

2 Phytologia (April 2009) 91(1)
B. L. Turner. Taxonomy of /Jva angustifolia and I. asperifolia -
(ASTErACERE) i550. sas adnrne somceco eemeat aae tamer tne tna uot ke iaieaiecabe saa eee 1G.

B. L. Turner. A new species of Trixis (Asteraceae: Mutisieae) from i
JAaliSCOMMIENICO’ oo. posisciassotycan cucee ee RS eee nee caja see a oe ee 84

B. L. Turner. Carminatia papagayana (Asteraceae: Eupatorieae), A new
Species from western Guerrero; MIEXICO) a sce 5 es dt <n 88

W. A. Weber and R. C. Wittmann. Delwiensia, a new genus of /~
ASICTACEAG’ «iain 's5 oes Gi vadene'sinp's suelesnsite ons aakeeine pees anes ee 92

D. B. Ward. Zamia floridana (Zamiaceae), the correct name of the
Florida

CV CA ois postr bpatvuass sede ak pou etic dyenuc atom iaarcd Aca ae ea ee oS
S. J. Galla, B. L. Viers, P. E. Gradie and D. E. Saar. Morus murrayana _
(Moraceae): A new mulberry from eastern North America............ 105 ~

R. P. Adams. Analyses and taxonomic utility of the cedarwood oils of
the serrate leaf junipers of the western hemisphere...................... bay

Z. Debreczy, K. Musial, R. A. Price and I. Racz. Relationships and
nomenclatural status of the Nootka cypress (Callitropsis nootkatensis, _/
CUpFeSSaCEds) co casienasae i vive ctamcamnee tases came eeerte aeons see 140 ~

R. P. Adams, J. A. Bartel and R. A. Price. A new enue
Hesperocyparis, for the cypresses of the western hemisphere

3 Phytologia (April 2009) 91(1)

THE GENUS RHYNCHOSIA (FABACEAE) IN ALABAMA

Michael Woods and Jann Key
Department of Biological and Environmental Sciences
Troy University, Troy, AL 36082, USA
mwoods@troy.edu

ABSTRACT

The genus Rhynchosia (Fabaceae), commonly known as snout
bean, is recognized as consisting of five species and no infraspecific
taxa in Alabama. The most common species are R. tomentosa, R.
reniformis, and R. difformis. The least common species are R.
cytisoides and R. minima. Dichotomous keys and descriptions were
generated based on morphological features of the vegetative and
reproductive structures of the more than 400 specimens studied during
this project. Data for the county-level distribution maps were compiled
entirely from herbaria vouchers. Phytologia 91(1):3-17,( April, 2009).

KEY WORDS: Fabaceae, Leguminosae, Rhynchosia, Alabama

Rhynchosia Loureiro, commonly known as snout bean, is a
member of the legume family Fabaceae (Leguminosae), subfamily
Papilionoideae, tribe Phaseoleae, subtribe Cajaninae (Lackey 1981).
The genus consists of approximately 200 species and occurs in both the
eastern and western hemisphere in warm temperate and tropical regions
(Grear 1978). Fourteen species and two infraspecific taxa of
Rhynchosia have been reported from the United States (NatureServe
2005). Of these, ten species and one infraspecific taxon have been
reported from the southeastern United States (Isely 1990).

Vail (1899) revised the genus for the taxa occurring in the
United States. She recognized 16 taxa but used the genus Dolicholus
Medikus and listed Rhynchosia as a synonym. For the next 60 years,
the names Dolicholus and Rhynchosia were both used in the literature.
It was not until 1959 when, under the provisions of the /nternational
Code of Botanical Nomenclature, Rhynchosia was conserved against
Dolicholus (Rickett and Stafleu 1959).

Phytologia (April 2009) 91(1) 4

In the only comprehensive revision of the New World species
of Rhynchosia, Grear (1978) solved many of the problems of
nomenclature, taxonomy and distribution with which previous workers
had dealt.

METHODS

The data for the distribution maps were gathered from more
than 400 specimens deposited in the herbaria of Troy University
(TROY), Auburn University (AUA), The University of Alabama
(UNA), The University of South Alabama (USAM), Jacksonville State
University (JSU), University of North Alabama (UNAF), Smithsonian
Institution (US), and Vanderbilt University (VDB), which is located at
the Botanical Institute of Texas (BRIT) in Fort Worth.

The dichotomous keys are modifications of Isely (1990) and
Weakley (2007); however, all measurements are based on
morphological features of the vegetative and reproductive structures of
the plants analyzed during this study. Descriptions for each taxon are
based on Grear (1978) and Isely (1990); however, measurements were
taken from the specimens studied and incorporated into the descriptions
if they differed. Illustrations of Rhynchosia cytisoides (Bertoloni)
Wilbur and R. minima (Linnaeus) de Candolle are by the first author.
All other illustrations are from Britton and Brown (1913). The lists of
specimens examined are limited to one record from each county.

Herbarium specimens were initially divided into groups based
on overall morphological similarity and the species concepts
established by Isely (1990) and Weakley (2007). Morphological
measurements were then made from selective specimens of each group.

RESULTS

Five species and no infraspecific taxa of Rhynchosia have
been documented from Alabama. Based on herbarium specimens, the
most common species are R. tomentosa (Linnaeus) Hooker & Arnott
(48 counties), R. reniformis de Candolle (24 counties), and R. difformis
(Elliott) de Candolle (16 counties). The least common species are R.

5 Phytologia (April 2009) 91(1)

cytisoides (Bertoloni) Wilbur (8 counties) and R. minima (Linnaeus) de
Candolle (2 counties).

TAXONOMIC TREATMENT OF RHYNCHOSIA

Rhynchosia Loureiro, Fl. Cochinch. 425, 460. 1790. nom. cons.
Dolicholus Medikus, Vorl. Churpf. Phys. Okon. Ges. 2: 354.
1787. nom. rejic.

Cylista Aiton, Hort. Kew. ed. 1, 3: 36, 512. 1789. nom. rejic.
Arcyphyllum Elliott, Jour. Acad. Phila. 1: 371. 1818.
Austerium Poit. ex DC., Prodr. 2: 385. 1825. nom. nudum.
Polytropia Presl, Symb. Bot. 21, t. 13. 1831.

Nomismia Wight & Arnott, Prodr. 1: 236. 1834.
Cyanospermum Wight & Arnott, Prodr. 1: 259. 1834.
Pitcheria Nuttall, Jour. Acad. Phila. 7: 93. 1834.

Hidrosia E. Meyer, Comm. PI. Afr. Aust. 1: 89. 1836.
Orthodanum E. Meyer, Comm. PI. Afr. Aust. 1: 131. 1836.
Copisma E. Meyer, Comm. PI. Afr. Aust. 1: 132. 1836.
Chrysoscias E. Meyer, Comm. Pl. Afr. Aust. 1: 139. 1836.
Rynchosia J. Macfadyen, Fl. Jam. 1: 275. 1837.
Phyllomatia Benth., Ann. Wien. Mus. 2: 113. 1839.
Ptychocentrum Benth., Ann. Wien. Mus. 2: 113. 1839.
Chrysonias Benth., Ann. Wien. Mus. 2: 114. 1839.
Phaseolus subgenus Rhynchosia Eaton & Wright, N. Amer.
Bot. 353. 1840.

Sigmodostyles Meissn., Hook. Lond. Jour. Bot. 2: 93. 1843.
Walpersia Meissn. ex Krauss, Flora 27: 357. 1844.
Rhinchosia Zoll. & Mor., Natuur-en Geneesk. Arch. Neder.
Indie 3: 78. 1846.

Stipellaria Klotz., Schomb. Faun. Fl. Brit. Gui. 3: 1203. 1848.
nom. nudum.

Hydrosia A. Juss., Orbigny: Dict. Hist. Nat. 7: 270. 1849.
Leycephyllum Piper, Jour. Wash. Acad. 14: 363. 1924.
Leucopterum Small, Man. S. E. Fl. 713. 1933.

Roots perennial. Stems herbaceous, trailing, twining, or erect,
simple or branched, glabrous to pubescent. Leaves unifoliate or
pinnately trifoliate; petioles 1-90 mm long; leaflets entire, elliptic to
rhomboid, 10-70 mm long, glabrous to pubescent, glandular punctuate

Phytologia (April 2009) 91(1) 6

with yellow, dome-shaped, resin glands. Inflorescence pseudoracemes,
axillary or short terminal; peduncles 1-90 mm long. Calyx 2.5-12.0
mm long; corolla yellow, some with purple to brown veins, 4-10 mm
long; stamens 10, diadelphous (9 + 1); styles glabrous; ovaries glabrous
to pubescent; ovules 1-2. Fruits 10-20 mm long, dehiscent, short and
broad, asymmetrically ovate to oblong to falcate-oblong, laterally
compressed, short-beaked, glandular-punctate, pubescent.

KEY TO THE ALABAMA SPECIES OF RHYNCHOSIA

1. Leaves unifoliate, upper ones rarely trifoliate........... 1. R. reniformis
I; Leaves trifoliate, lower ones rarely unifoliate .....,..:../...00:eeeeeee
2: Corolla-exceedinig Calyx s1.. .1.0)-2.-sesondeshaviacaestescéeeusan. 2. 3
2; Corolla shorter than or equal’ to Calyx... oi.jc.ccdsetem << anensatemee eee
3. Plants erect; flowers single (-3) in leaf axils..............2. R. cytisoides
3. Plants trailing or twining; flowers in racemes...............3. R. minima
4. Plants erect; calyx 6-9 mm long; lower leaflet surface grayish
LOMICHLOSE 22 iiss jo iecie ¥e« 0085 dae Slew ve deunieg Se getendccmeneAe os RO
4. Plants trailing, twining, semi-erect; calyx 8-12 mm long;
lower leaflet surface VillOSE. 2.0... ...02<sc0soreseeeev22ss0 Ds Aho a eens

1. Rhynchosia reniformis de Candolle, Prodr. 2: 384. 1825.

[Figure la]
Trifolium simplicifolium Walter, Fl. Carol. 184. 1788.
Glycine tomentosa Linnaeus var. monophylla Michaux, F1.
Bor.-Amer. 2: 63. 1803.
Glycine reniformis Pursh, Fl. Amer. Sept. 486. 1814, nom.
illegit.
Arcyphyllum simplicifolium (Walter) Elliott, J. Acad. Nat. Sci.
Philadelphia 2: 115. 1818.
Glycine monophylla (Michaux) Nuttall, Gen. N. Amer. PI. 2:
115. 1818, nom. illegit. et non Linnaeus 1767.
Glycine simplicifolia (Walter) Elliott, Sketch Bot. S. Carolina
2: 234. 1823.
Phaseolus reniformis (de Candolle) Eaton & J. Wright, Man.
Bot., ed. 8. 353. 1840, nom. illegit.
Psoralea alnifolia Bertoloni, Mem. Reale Accad. Sci. Ist.
Bologna 2: 274, t. 4(1). 1850.

7 Phytologia (April 2009) 91(1)

Psoralea alopecurina Bertoloni, Mem. Reale Accad. Sci. Ist.
Bologna 2: 275, t. 4(2). 1850.

Rhynchosia simplicifolia (Walter) A. W. Wood, Class-Book
Bot., ed. 1861. 321. 1861, non de Candolle 1825.

Rhynchosia tomentosa (Linnaeus) Hooker & Arnott var.
monophylla (Michaux) Torrey & A. Gray, Fl. N. Amer. 1:
284. 1838.

Rhynchosia tomentosa (Linnaeus) Hooker & Arnott, var.
intermedia Torrey & A. Gray, Fl. N. Amer. 1: 285. 1838.
Dolicholus simplicifolius (Walter) Vail, Bull. Torrey Bot. Club
26: 114. 1899.

Dolicholus intermedius (Torrey & A. Gray) Vail, Bull. Torrey
Bot. Club 26: 115. 1899.

Rhynchosia intermedia (Torrey & A. Gray) Small, Man. S.E.
FF ES: 1933.

Rhynchosia simplicifolia (Walter) A. W. Wood var.
intermedia (Torrey & A. Gray) F. J. Hermann, J. Wash. Acad.
Sci. 38: 238. 1948.

Roots perennial. Stems erect, simple or branched, villous.
Leaves 4-6, unifoliate, upper one rarely trifoliate; petioles 20-45 mm
long; leaflets reniform or subcordate, 25-50 mm long, strigose above,
hirsute beneath, especially along the veins. Inflorescence short and
subsessile; peduncles 5-20 mm long. Calyx 7-10 mm long, lobes
longer than tube; corolla yellow, 6.0-9.5 mm long, subequal to calyx.
Fruits shortly oblong or elliptic-oblong, 12-18 mm long, villous
especially along the sutures.

Habitat and distribution in Alabama: dry woods, sandhills,
fields and roadsides; throughout the southern half of the state (Figure
1b).

Specimens examined. Autauga County: Kral 33542, 4 October
1968 (VDB). Baldwin County: Lelong 7868, 15 June 1974 (USAM).
Barbour County: MacDonald 10465, 12 May 1997 (VDB). Bullock
County: Keys 83, 10 May 1963 (AUA). Butler County: Diamond
17963, 23 September 2007 (TROY). Chilton County: Freeman 714,
20 May 1971 (AUA). Choctaw County: Kral 39661, 4 June 1970
(VDB). Clarke County: Kral 43048, 6 June 1971 (VDB). Coffee
County: Martin 61, 24 June 1999 (TROY). Covington County:

Phytologia (April 2009) 91(1) 8

Diamond 14481, 7 July 2004 (AUA, TROY, UNA, VDB). Crenshaw
County: Diamond 10357, 23 July 1996 (AUA). Dale County:
Pennington 664, 7 May 2000 (TROY). Dallas County: Whetstone
14080, 9 June 1984 (JSU). Escambia County: Brittain 131, 5 May
1995 (TROY). Geneva County: Moore 435-69, 25 July 1969 (AUA).
Hale County: McKitrick 53, 4 July 1971 (AUA). Henry County: Kral
31959, 24 July 1968 (VDB). Lee County: Barnes 158, 22 May 1969
(AUA). Macon County: Redmond 147, 28 May 1970 (AUA). Mobile
County: Lelong 3066, 21 April 1967 (USAM). Monroe County:
Diamond 15899, 8 October 2005 (AUA, TROY, VDB). Pike County:
Diamond 11059, 28 July 1997 (AUA). Russell County: Gil 151, 2 May
2003 (AUA). Tuscaloosa County: Spaulding 11842, 11 May 2003
(JSU, TROY, UNA, VDB).

2. Rhynchosia cytisoides (Bertoloni) Wilbur, Rhodora 64: 60. 1962.
[Figure Ic]
Pitcheria galactoides Nuttall, J. Acad. Nat. Sci. Philadelphia
12793, 1834:
Pitcheria galactoides Nuttall var. parvifolia Torrey & A.
Gray, Fl. N. Amer. 1: 286. 1838.
Rhynchosia galactoides (Nuttall) Endlicher & Walpers, in
Walpers, Repert. Bot. Syst. 1: 790. 1842, non (Kunth) de
Candolle 1825.
Lespedeza cytisoides Bertoloni, Mem. Reale Accad. Sci. Ist.
Bologna 2: 278. 1850.
Rhynchosia pitcheria Burkart, Darwiniana 11(2): 268. 1957.

Roots perennial. Stems erect, branched, glabrous to villous.
Leaves trifoliate; petioles 1-4 mm long; leaflets ovate to elliptic, 10-20
mm long, finely strigose above, puberulent beneath. Inflorescence 1(-
3) flowered; peduncles 1-3 mm long. Calyx 5-7 mm long, lobes equal
or short than tube; corolla yellow with purple veins, 7-10 mm, equal or
longer than calyx. Fruits oblong, 12-20 mm long, puberulent.

Habitat and distribution in Alabama: dry open woods, sandy
pinehills; extreme southern part of state (Figure 1d).

Specimens examined. Baldwin County: Diamond 16587, 26
June 2006 (TROY). Covington County: Kral 33652, 5 October 1968

9 Phytologia (April 2009) 91(1)

(VDB). Dale County: Diamond 13177, 12 May 2002 (TROY).
Escambia County: Diamond 13196, 19 May 2002 (TROY). Geneva
County: Kral 35097, 7 June 1969 (AUA, VDB). Houston County:
Kral 43148, 9 June 1971 (AUA). Mobile County: Kra/ 39618, 3 June
1970 (JSU, VDB). Washington County: Kral 31/185, 6 June 1968
(UNA, VDB).

3. Rhynchosia minima (Linnaeus) de Candolle, Prodr. 2: 385. 1825.

[Figure le]
Dolichos minimus Linnaeus, Sp. Pl. 726. 1753.
Dolicholus minimus (Linnaeus) Medikus, Vorles. Churpfaelz.
Phys.-Oecon. Ges. 2: 354. 1787.
Glycine minor Lagascay Segura, Elench. Pl. 8. 1816, nom.
illegit.
Glycine reflexa Nuttall, Gen. N. Amer. Pl. 2: 115. 1818.
Glycine lamarckii Kunth, in Humboldt et al., Nov. Gen. Sp. 6:
424. 1824.
Rhynchosia punctata de Candolle, Prodr. 2: 385. 1825.
Rhynchosia rhombifolia (Willdenow) de Candolle var.
timoriensis de Candolle, Prodr. 2: 386. 1825.
Rhynchosia candollei Decaisne, Nouv. Ann. Mus. Hist. Nat. 3:
473. 1834.
Rhynchosia mexicana Hooker & Arnott, Bot. Beechey Voy.
287. 1841.
Rhynchosia aureoguttata Andersson, Kongl. Vetensk. Acad.
Handl. 1853: 252. 1855.
Rhynchosia exigua Andersson, Kongl. Vetensk. Acad. Handl.
HG552252: 1855:
Rhynchosia minima (Linnaeus) de Candolle var. /utea Eggers,
Bull. U.S. Natl. Mus. 13: 42. 1879.
Rhynchosia minima (Linnaeus) de Candolle var. pauciflora
Kuntze, Revis. Gen. Pl. 1: 204. 1891.
Rhynchosia minima (Linnaeus) de Candolle var. diminifolia
Walraven, Brittonia 22: 85. 1970.

Roots perennial. Stems trailing or twining, branched, glabrous
to puberulent or villous. Leaves trifoliate; petioles 5-90 mm long;
leaflets broadly ovate-acuminate to rhomboid, 10-35 mm long, glabrous
to villous, gland dotted. Inflorescence 5-15 flowered; peduncles 10-90

Phytologia (April 2009) 91(1) 10

mm long. Calyx 2.5-3.0 mm long, longest lobes equal or longer than
tube; corolla yellow with purple or brown veins, 4-8 mm, longer than
calyx. Fruits oblong-ovate to flacate, 10-20 mm long, villous.

Habitat and distribution in Alabama: disturbed pinelands;
known from two historical collections in south Alabama (Figure 1f).

Specimens examined. Autauga County: Mohr s.n., July 1869
(US). Mobile County: Mohr s.n., July 1870 (UNA).

4. Rhynchosia tomentosa (Linnaeus) Hooker & Arnott, Companion
Bot. Mag. 1: 23. 1835. [Figure 2a]

Glycine tomentosa Linnaeus, Sp. Pl. 754. 1753.
Trifolium erectum Walter, Fl. Carol. 184. 1788.
Arcyphyllum erectum (Walter) Elliott, J. Acad. Nat. Sci.
Philadelphia 1: 372. 1803.
Glycine tomentosa Linnaeus var. erecta (Walter) Michaux, FI.
Bor.-Amer. 2: 63. 1803.
Glycine erecta (Walter) Nuttall, Gen. N. Amer. Pl. 2:114.
1818, non Thunberg 1800.
Glycine mollissima Elliott, Sketch Bot. S. Carolina 2: 235.
1823.
Rhynchosia erecta (Walter) de Candolle, Prodr. 2: 384. 1825.
Glycine caroliniana Sprengel, Syst. Veg. 3: 197. 1826.
Rhynchosia tomentosa (Linnaeus) Hooker & Arnott var.
erecta (Walter) Torrey & A. Gray, Fl. N. Amer. 1: 285. 1838.
Dolicholus drummondii Vail, Bull. Torrey Bot. Club 26: 116.
1899.
Dolicholus erectus (Walter) Vail, Bull. Torrey Bot. Club 26:
115. 1899.
Dolicholus tomentosus (Linnaeus) Vail, Bull. Torrey Bot.
Club 26: 112. 1899.
Rhynchosia drummondii (Vail) K. Schumann, Bot. Jahrb. Syst.
26: 496. 1901.

Roots perennial. Stems erect, branched, densely villous.
Leaves trifoliate, lower one rarely unifoliate; petioles 15-50 mm long;
leaflets broadly ovate to elliptic, 35-70 mm long, densely puberulent or
tomentose above, tomentose below. Inflorescence axillary, 10-30 mm

11 Phytologia (April 2009) 91(1)

long, and short terminal, 7-15 mm long; peduncles 5-15 mm long.
Calyx 5-9 mm long, lobes longer than tube; corolla yellow, 5-10 mm,
equal or short than calyx. Fruits ovate-oblong to broadly oblong, 15-20
mm long, hirsute and puberulent.

Habitat and distribution in Alabama: dry woodlands,
sandhills, woodland borders, rich woodlands; scattered throughout the
state (Figure 2b).

Specimens examined. Autauga County: Diamond 6179, 29
July 1989 (AUA). Baldwin County: Moore 83, 15 May 1955 (AUA).
Barbour County: MacDonald 11492, 27 June 1998 (UNA). Blount
County: Keener 910, 6 June 1998 (UNA). Bullock County: Diamond
14165, 18 September 2003 (AUA, JSU, TROY, UNA, VDB). Butler
County: Diamond 17964, 23 September 2003 (TROY). Calhoun
County: Whetstone 12207, 9 September 1982 (JSU). Cherokee County:
Kral 47626, 12 July 1972 (VDB). Chilton County: Diamond 15567,
27 July 2005 (TROY, VDB). Choctaw County: Moore 949, 8
September 1970 (AUA). Clarke County: Kral 41122, 5 September
1970 (VDB). Clay County: Rutland 460, 23 June 1975 (AUA).
Cleburne County: Adams s.n., 27 June 1957 (AUA). Colbert County:
Kral 67598, 26 July 1981 (VDB). Conecuh County: Diamond 11983,
13 August 2000 (TROY). Coosa County: Rutland 1159, 2 September
1975 (AUA). Covington County: MacDonald 13273, 24 July 1999
(VDB). Crenshaw County: Diamond 16398, 17 May 2006 (TROY).
Dale County: Rundell 260, 1 July 1997 (TROY). DeKalb County:
Price 101, 25 July 1970 (AUA). Elmore County: McDaniel 7773, 28
September 1966 (UNA). Etowah County: Hodge & Spaulding
2716/6893, 23 June 1994 (JSU). Fayette County: Haynes 9593, 20
September 1997 (UNA). Geneva County: MacDonald 12933, 29 May
1999 (VDB). Greene County: Thomas 1695, 3 June 1968 (UNA).
Hale County: Maginness 316, 13 June 1966 (UNA). Houston County:
Kral 40011, 16 July 1970 (UNA, VDB). Jackson County: Whetstone
4528, 5 August 1994 (JSU). Jefferson County: Barber 922, 27 July
1984 (JSU). Lamar County: Kral 39789, 27 June 1970 (UNA).
Lauderdale County: Kral 69506, 20 July 1982 (VDB). Lee County:
Robertson 81, 23 August 1924 (AUA). Lowndes County: Diamond
14736, 30 September 2004 (AUA, TROY). Macon County: Moore
300, 9 July 1970 (AUA). Marengo County: Kra/ 31220, 6 June 1968

Phytologia (April 2009) 91(1) es

(VDB). Marshall County: Spaulding 2286, 12 July 1992 (JSU).
Mobile County: Lelong 6513, 24 May 1972 (USAM). Morgan County:
Kral 41169, 22 September 1970 (VDB). Randolph County: Nixon et
al., 4061, 15 July 1988 (JSU). Russell County: Kral 62284, 8 July
1978 (JSU, VDB). Shelby County: Kral 51154, 11 August 1973
(UNA). St. Clair County: Kral 65949, 3 July 1980 (TROY). Sumter
County: Spaulding 12036, 24 August 2003 (AUA, JSU, TROY, UNA,
VDB). Talladega County: Rutland 1040, 29 August 1975 (AUA).
Tallapoosa County: Kral 62150, 25 June 1978 (JSU, VDB).
Tuscaloosa County: Burdett 72, 26 June 1971 (AUA). Wilcox County:
Kral 82408, 21 May 1993 (VDB).

5. Rhynchosia difformis (Elliott) de Candolle, Prodr. 2: 384. 1825.

[Figure 2c]
Glycine tomentosa Linnaeus var. volubilis Michaux, Fl. Bor.-
Amer. 2: 63. 1803.
Arcyphyllum difforme Elliott, J. Acad. Nat. Sci. Philadelphia 1:
372.1818.
Rhynchosia tomentosa (Linnaeus) Hooker & Arnott var.
volubilis (Michaux) Torrey & A. Gray, Fl. N. Amer. 1: 284.
1838.
Rhynchosia volubilis A. W. Wood, Class-Book Bot., ed. 1861.
321. 1861, non Loureiro 1790.
Dolicholus lewtonii Vail, Bull. Torrey Bot. Club 26: 113.
1899.
Dolicholus tomentosus (Linnaeus) Vail var. undulatus Vail,
Bull. Torrey Bot. Club 26: 113. 1899.
Rhynchosia lewtonii (Vail) Small, Man. S.E. Fl. 714. 1933.

Roots perennial. Stems trailing, twining, rarely semi-erect,
simple or branched, strigose or hirsute. Leaves trifoliate, lower one
rarely unifoliate; petioles 20-50 mm long; leaflets suborbicular to
elliptic, 25-50 mm long, glabrous to strigose above, villose below.
Inflorescence axillary, 10-20 mm long; peduncles 5-15 mm long.
Calyx 8-12 mm long, lobes longer than tube; corolla yellow, 8-10 mm,
equal or short than calyx. Fruits ovate-accuminate to broadly oblong,
12-20 mm long, puberulent and villous.

13 Phytologia (April 2009) 91(1)

Habitat and distribution in Alabama: mixed and deciduous
woodlands, sandhills, old fields and roadsides; throughout southeast
Alabama and widely scattered in the northern one-half of the state.
(Figure 2d).

Specimens examined. Autauga County: Gunn 708, 14 June
1982 (AUA, UNA). Barbour County: Moore 441, 29 July 1970
(AUA). Butler County: Diamond 12123, 9 September 2000 (TROY).
Coffee County: Martin 873b, 10 August 2000 (TROY). Crenshaw
County: Diamond 11435, 11 October 1998 (AUA). Dale County:
Rundell 408, 29 August 1997 (TROY). Dallas County: Kral 32774, 21
August 1968 (VDB). Fayette County: Moore 2977, 14 September 1954
(AUA). Henry County: Kral 79307, 30 June 1991 (VDB). Houston
County: Kral 35747, 25 July 1969 (VDB). Jackson County:
Henderson 472, 25 July 1981 (AUA). Macon County: Botts 189, 2
July 1976 (AUA). Montgomery County: Diamond 12474, 3 July 2001
(TROY). Pike County: Hall 138, 21 September 2000 (TROY).
Russell County: Kral 62065b, 19 June 1978 (VDB). Talladega County:
Mohr 407, June 1892 (UNA).

DISCUSSION

In Alabama, Rhynchosia, is a common genus of open, dry
woodlands, savannahs, prairie openings, fields and roadsides. The taxa
can normally be recognized by a combination of conspicuously
glandular foliage, yellow corolla, and 1-2 seeded pods.

Both Alabama collections of Rhynchosia minima (Linnaeus)
de Candolle are historical. Charles Mohr made the Autauga County
collection in July 1869 and the Mobile County collection in July 1870.
It is possible that this species has been extirpated from the state.
However, a collection by James Burkhalter in September 1987 from
Escambia County, Florida, documents the continued presence of the
species immediately adjacent to Alabama.

Of the 146 herbarium specimens of Rhynchosia tomentosa
(Linnaeus) Hooker & Arnott that were studied during this project, all
were the typical variety. The second variety, R. tomentosa var.
mollissima (Elliott) Torrey & Gray is known from Florida, Georgia and

Phytologia (April 2009) 91(1) 14

South Carolina. In Florida, it has been reported from Leon County,
which is approximately 100 km southeast of Houston County,
Alabama. Because of the proximity of the Florida collection to
Alabama, this taxon possibly occurs in the southeastern section of the
state. The typical variety has persistent stipules, several axillary
inflorescences, 1-3 cm long and an occasional short terminal raceme.
Variety mollissima differs from the typical variety by having caducous
stipules and a single, strongly exerted, terminal inflorescence 5-20 cm
long.

Rhynchosia michauxii Vail is another taxon that possibly
occurs in the southern tier of Alabama counties. Although this taxon
has not been reported from state, it does occur in Okaloosa County,
Florida, which is immediately south of Covington and Escambia
Counties.

ACKNOWLEDGEMENTS

The authors thank the curators of the various herbaria who
loaned specimens. Special thanks are extended Dr. Brian Keener and
Al Schotz for reviewing this manuscript.

LITERATURE CITED

Britton, N.L. and A. Brown. 1913. An illustrated flora of northern
United States and Canada. 1* ed. 3 vols. Charles Scribner’s Sons,
New York, New York.

Grear, J.W. 1978. A revision of the New World species of Rhynchosia
(Leguminosae-Faboideae). Mem. New York Bot. Gard. 31: 1-168.

Isely, D. 1990. Vascular flora of the southeastern United States.
Volume 3, Part 2. Leguminosae (Fabaceae). The University of
North Carolina Press, Chapel Hill, North Carolina.

Lackey, J.A. 1981. Phaseoleae. In Pohill, R.M. and P.H. Raven
(editors). Advances in legume systematics. Volume 1. Royal
Botanical Garden, Kew, Richmond, England, p. 301-327.

15 Phytologia (April 2009) 91(1)

NatureServe 2005. NatureServe Explorer: An online encyclopedia of
life [web application]. Version 4.6.
http://www.natureserve.org/explorer). NatureServe, Arlington,

Virginia.

Rickett, H.W. and F.A. Stafleu. 1959. Nomina generica conservanda et
rejicienda spermatophytorum III. Taxon 8: 282-314.

Vail, A.M. 1899. Studies in the Leguminosae III. Notes on the genus
Dolicholus (Rhynchosia) in the United States. Bull. Torrey Club
26: 106-117.

Weakley, A.S. 2007. Flora of the Carolinas, Virginia, and Georgia.
Working draft: January 2007. University of North Carolina
Herbarium, North Carolina Botanical Garden, Chapel Hill, North
Carolina.

Phytologia (April 2009) 91(1) 16

*
=
4
i
; Jf ps
‘ev °
a Oo oe
eX OFC. OTe
® me be by OF
e- i
° prevents 3 :
eal fel" 6
H ° a f e
ee
Si anki
'
?
\ i yo
2 =
x id Masia
panak
“ ; }
e.. i oe
<P { ® j “*
ej e.

r
~ U ’
Seog
+ ,
} *
ye
4 ~ g ‘
ohn ;
7 wh ; 4
i si
¥ f
“ ¥ nt

Figure 1. a) illustration of Rhynchosia reniformis, b) distribution of R.
reniformis, Cc) illustration of R. cytisoides, d) distribution of R.
cytisoides, e) illustration of R. minima, f) distribution of R. minima

17 Phytologia (April 2009) 91 (1)

he °
Ld y
ee *®
_ @
: e *
ee e es
ve “Vel
e _@ e
; e F [29
@’gr- ee 8
on | free ~0@.
*@ < ie ee
e [
r a, e
e ee
} e- ®
o j © - 6
ee ;
aa
&
'
e r
7
) - af
- een e
: van
\@e@@ ‘
i ity
d
hed

Figure 2. a) illustration of Rhynchosia tomentosa, b) distribution of R.
tomentosa, c) illustration of R. difformis, d) distribution of R. difformis.

18 Phytologia (April 2009) 91(1)

KEYS TO THE FLORA OF FLORIDA: 21,
CRATAEGUS (ROSACEAE)

Daniel B. Ward
Department of Botany, University of Florida
Gainesville, Florida 32611, U.S.A.

ABSTRACT

Crataegus (Rosaceae) is represented in Florida by 11 species.
The name Crataegus michauxii is reaffirmed for the Summer Haw; the
species is treated as consisting of 2 varieties, with var. lacrimata newly
ranked. Crataegus phaenopyrum is rated as endangered. An amplified
key is given to the Florida taxa. Phytologia 91(1):18-25, (April, 2009).

KEY WORDS: Crataegus, Rosaceae, Florida flora.

"No wonder you ponder my application of names to the
Hawthorns. But with so many children of my imagination,
and the free use by others in naming their offspring, names
with sympathetic tolerance and interpretation with their
subjects are much in demand." Chauncey D. Beadle, 2
September 1940, letter to William A. Murrill, in response to
Murrill's complaint that species of Crataegus had become so
numerous that all suitable epithets had already been used.

Crataegus (Rosaceae), the hawthorns, has received its full
share of attention from several prolific authors. Their energies have
generated impressive , even unmanageable, numbers of specific names.
Few perhaps now remember that in J. K. Small's early Flora of the
Southeastern United States (1903), C. D. Beadle described and named
185 species of Crataegus, and that fully 47 of them were from Florida.
Some relief was felt when, in Small's revised Manual of the
Southeastern Flora (1933), Ivar Tidestrom reduced this number of total
southeastern species to 33 and the Florida species to 11. Even better --
from the standpoint of persons with finite retentive powers -- R. K.

Phytologia (April 2009) 91(1) 19

Godfrey, in his Trees, Shrubs and Woody Vines (1988), saw fit to
recognize only 9 species in the three-state Southeast, all to be found in
Florida.

Even as some writers were winnowing the published names of
Crataegus, other investigators were adding to the list. T. G. Harbison
and W. W. Ashe, operating from the Biltmore Herbarium, North
Carolina; E. J. Palmer and C. S. Sargent, with the Arnold Arboretum,
Massachusetts; and W. A. Murrill, University of Florida, Gainesville,
all found variations in southeastern and Florida hawthorns that they
believed merited naming.

But with the passage of years a new champion of the
hawthorns had arisen, whose reports again serve to push the number of
recognized species ever upward. J. B. Phipps, based at the University
of Western Ontario, began to search the continent, to study and collect
Crataegus, and has now excellently documented, described, mapped
and beautifully illustrated most series within the genus. He has
skillfully addressed: C. aestivalis, C. opaca, and C. rufula (J. Arnold
Arbor. 69: 401-431. 1988); C. marshallii, C. phaenopyrum, and C.
spathulata (Ann. Missouri Bot. Gard. 85: 475-491. 1998); and C.
uniflora (with Dvorsky, Sida 22: 423-445. 2006). He determined
Aiton's widely used C. flava is not the familiar Summer Haw (Taxon
37: 108-113. 1988). Though he made no reassignment himself, the
characteristics and specimens he cited point to it being the Smooth
Haw, C. pulcherrima, a name of later date. In turn -- though Phipps
(below) argues to the contrary -- the Summer Haw s./. now must
become C. michauxii Persoon. (This name has independently been
accepted by R. P. Wunderlin, Guide to the Vascular Plants of Florida.
1998.)

The present treatment, however, must take issue with two
recent studies by J. B. Phipps & K. A. Dvorsky (J. Bot. Res. Inst. Texas
1: 171-202. 2007; ibid. 2: 1101-1162. 2008). In the first of these papers
(2007), 13 species described by C. D. Beadle (1902, 1903) and E. J.
Palmer (1932) are redescribed, mapped, illustrated, and given new life
as species recognized by someone other than their original author.

20 Phytologia (April 2009) 91(1)

Eight are reported to occur in Florida (C. annosa Beadle, C. aprica
Beadle, C. egregia Beadle, C. galbana Beadle, C. leonensis Palmer, C.
mira Beadle, C. segnis Beadle, C. visenda Beadle). In the second of
these papers (2008) a further 26 species are described, fully 20 of them
to be found in Florida (C. alabamensis Beadle, C. attrita Beadle, C.
condigna Beadle, C. crocea Beadle, C. dispar Beadle, C. egens Beadle,
C. florens Beadle, C. floridana Sarg., C. furtiva Beadle, C. integra
(Nash) Beadle, C. lacrimata Small, C. lanata Beadle, C. lancei J. B.
Phipps, C. /assa Beadle, C. lepida Beadle, C. meridiana Beadle, C.
munda Beadle, C. quaesita Beadle, C. senta Beadle, C. vicana Beadle).
[Of these entities, only C. /acrimata is recognized here.] Nearly all of
these reported species are infrequent to rare, many with very restricted
locations or with disjunct ranges extending over wide areas. Though
the species are carefully keyed, the distinctions are slight. Phipps &
Dvorsky maintain these plants to be different from C. michauxii (the
Summer Haw, as treated here), the first eight not even in the same
series. Though one wishes to acknowledge Phipps' judgments, as
merited by the value of his previous studies (above), one cannot but
view these "species" as apomictic populations, unworthy of being
placed alongside the taxa that elsewhere constitute the genus
Crataegus. They exactly parallel the many discrete but too finely
distinguished agamospermic populations also encountered in Rubus
(Phytologia 87: 29-39. 2005).

As noted (above), the reassignment of Crataegus flava to the
hawthorn formerly known as C. pulcherrima has left C. michauxii Pers.
the prior name for the Summer Haw. However Phipps & Dvorsky now
reject that name. Their argument (2008: 1102-1103) is based on the
claim that Michaux' type (at P) is "simply a piece from a vigorously
growing extension shoot of an unidentifiable species." Although
Michaux' original name, C. glandulosa (1803) was a later homonym (of
C. glandulosa Georgi, 1776), Persoon (1806) based his C. michauxii on
the Michaux description and specimen. That specimen (P, fiche 65,
image 9) is one of 9 images of Crataegus, all collected by Michaux
during his decade-long (1785-1796) exploration of eastern North
America. It consists of a single slightly zigzag stem bearing 4 long
spines and 8 leaves, each with nearly orbicular blades and well-defined

Phytologia (April 2009) 91(1) 21

petioles. Numerous glands and minute teeth can be discerned on the
lower blade margins. The only label data are the words "glandulosa"
and "(varietas?)," in Michaux' hand. Far from being "unidentifiable,"
its image very nearly matches the illustration of C. condigna Beadle, as
shown by Phipps & Dvorsky (2008: 1125). It is certainly a Summer
Haw, as commonly understood. The name Crataegus michauxii Pers.
(1806) remains well-based and prior.

The Florida variability found within Crataegus michauxii
justifies inclusion under that name of nine synonyms (see the key), all
typified by Florida plants -- by Beadle, Palmer, Sargent, and Small.
Within this complex the Weeping Haw, C. /acrimata, of the Florida
panhandle sandhills stands out, both as to substantial but discrete range
and adequately distinct morphology (pendent branches, narrowly
spatulate leaves). It is at times recognized at specific rank (Small,
1933; Kurz & Godfrey, 1962; Little, 1979).

But there is also a case to be made for leaving Crataegus
lacrimata submerged within the greater apomictic C. michauxii
complex. Even in the heart of its Florida panhandle range one can
readily find plants -- or more commonly, branchlets within plants -- that
are intermediate or seemingly of the second taxon. This phenomenon is
not discussed by Phipps, though he twice illustrates it: a specimen
labeled C. lacrimata (2008: 1113), and a specimen labeled C. /assa
(2008: 1137). In each, lower leaves are narrow, appropriate to C.
lacrimata, while the more terminal leaves are broad, readily identifiable
as C. michauxii. Varietal status, as given here, is an approximate way
of acknowledging this curious intermediacy. A new combination is
required.

Crataegus michauxii Persoon var. lacrimata (Small) D. B.
Ward, comb. et stat. nov. Basionym: Crataegus lacrimata J.
K. Small, Torreya 1:97. 1901. TYPE: Holotype: United
States, Florida, Okaloosa Co., Crestview. C. D. Beadle,
Biltmore Herbarium B-17 and B-969, 8 April 1899 (NY).
Isotype (cited as lectotype by Phipps & Dvorsky 2008: 1112):
C. D. Beadle 17, 8 April 1899 (US).

22 Phytologia (April 2009) 91(1)

]

—

CRATAEGUS L. Hawthorns *

.Flowers and fruits solitary, on short (1-3 mm.) pedicels; sepals

prominent, persistent in fruit, broad at base, with coarsely serrate
margins; leaves glossy green above, elliptic to obovate, with regular
crenate teeth on apical half, the lower margins entire; fruits dull
brown, 10 mm. dia.; thorns +3 cm. long, slender and gray. Shrub or
rarely small tree. Understory in moist woodlands. North Florida (s.
to Marion County); frequent. Spring. [Crataegus croomiana Sarg.]
ONE-FLOWERED HAW. Crataegus uniflora Muench.

.Flowers and fruits in corymbs of several (or if solitary, on long (10-

15 mm.) pedicels); sepals not prominent, entire or weakly serrate,

often withering in fruit; leaves various.

2.Leaves red-maplelike, with 2 (or 4) sharply pointed lateral lobes;
fruits red, 4-5 mm. dia.; thorns 1-2 cm. long. Small tree. Low
woodlands. | _Mid-panhandle (Washington; Wakulla counties:
Ochlockonee R.); rare. Spring. ENDANGERED (State listing).
[Crataegus youngii Sarg. ]
WASHINGTON HAW. Crataegus phaenopyrum (L.f.) Medic.

2.Leaves not maplelike, unlobed or with irregularly rounded lateral

lobes (the apex rounded or acute).

3.All leaves deeply and symmetrically divided, with some sinuses
nearly reaching the midrib, the lobes sharply incised; fruits small
(5-6 mm. dia.), bright red, solitary or in corymbs of several; thorns
nearly lacking. Small tree. Wet floodplain forests, moist wooded
slopes. Panhandle and north Florida (s. to Marion County; excl.
n.e. Fla.), disjunct to mid-peninsula (Hillsborough County);
infrequent and local. Early spring.
PARSLEY HAW. Crataegus marshallii Egglest.

3.All leaves either unlobed or with irregular shallow lobes.
4.Fruits very small (3-4 mm. dia.), in several-flowered glabrous
corymbs; leaves glabrous when mature, spatulate with long-
cuneate bases and rounded crenately toothed apices, sometimes
with three apical lobes; veins largely (except the lower midrib)
immersed in leaf tissue, without sunken axil pockets; thorns
nearly lacking. Spindly shrub or small tree. Moist calcareous

Phytologia (April 2009) 91(1) 23

wooded slopes, mostly near the Apalachicola R. bluffs
(Gadsden, Jackson, Liberty counties); infrequent and local.
Spring.

RED HAW. Crataegus spathulata Michx.

4.Fruits larger (>4 mm. dia.), or if small, with sharply serrate
leaves; leaves and inflorescences usually with some hairs; lateral
veins protruding above lower leaf surface.

5.Leaves, or at least some, with acute apices; blades elliptic,

unlobed or with 2-4 lateral lobes.

6.Fruits medium (4-7 mm. dia.), usually in several-flowered
corymbs; lower surface of leaves with small sunken pockets
in axils of major veins; thorns few. Small to mid-sized tree.
Floodplains, riverbottom forests, swamps. Panhandle and
north Florida, south to north peninsula (Marion County);
frequent. Early spring. [Crataegus paludosa Sarg.]
GREEN HAW. Crataegus viridis L.

6.Fruits large (6-15 mm. dia.), solitary or usually so (if several

together, usually not of the same corymb).

7.Lower surface of leaves with pockets lacking in vein axils;
petioles distinct, the blade cuneate at base but not extended
downward; leaves usually with 2-4 shallow sharply-serrate
lobes; thorns few. Small to mid-size tree. Open
woodlands, moist hammocks and slopes. Panhandle,
locally eastward (to Alachua, Columbia, Levy counties);
frequent. Spring. [Crataegus opima Beadle; Crataegus
pulcherrima Ashe; Crataegus rober Beadle]
SMOOTH HAW. Crataegus flava Ait.

7.Lower surface of leaves with prominent hair-filled sunken
pockets in axils of major lateral veins (domatia); leaves
unlobed or deeply but irregularly cut or lobed; petioles
indistinct, changing gradually into cuneate-based blade.
8.Leaves 3-5 cm. long, serrate or crenate toward apex,
glossy above, nearly glabrous below; thorns few. Shrub
or small tree. Pond margins, creek banks. Mid-
panhandle (Gadsden County), east to northeast Florida
(Nassau County), south along east coast (to Volusia
County); frequent. Early spring. [Crataegus luculenta
Sarg.; Crataegus maloides Sarg.]

Phytologia (April 2009) 91(1)

MAY HAW. Crataegus aestivalis (Walt.) Torr. & Gray

8.Leaves 5-7 cm. long, entire or finely serrate-crenate
toward apex, dull green above, densely rufous-tomentose
below when young, persisting along veins when full-
grown.

9.Leaves elliptic to broad-elliptic; lateral veins 5-9;
pedicels glabrous; fruits 12-15 mm. dia. Small tree.
Stream and river banks. Western panhandle (n.e.
Escambia County: Century); rare. Spring.
APPLE HAW. Crataegus opaca Hook. & Arn.

9.Leaves broad-elliptic to obovate; lateral veins 3-5;
pedicels rufous-tomentose; fruits 10-12 mm. dia. Small
tree. River bottoms. Central panhandle (Jackson,

Gadsden counties); rare. [Crataegus aestivalis,
misapplied]
RUFOUS MAY HAW. Crataegus rufula Sarg.

5.Leaves with rounded apices, or a few acute; blades
oblanceolate to spatulate, without lobes (or some leaves
irregularly lobed on vigorous shoots of C. michauxii); fruits
large (6-12 mm. dia.).

10.Leaves glossy green above, without glands on petioles or
margins, without pockets (domatia) in vein axils; thorns
usually very prominent (3-4 cm. long). Small tree.
Floodplain forests, moist hammocks. North Florida (excl.
w. panhandle), south into north peninsula (to Clay, Levy
counties); frequent. Spring. [Crataegus pyracanthoides
Beadle]
COCKSPUR HAW. Crataegus crus-galli L.

10.Leaves uniformly light green above and below; petioles
and margins with dark button-like glands; lower leaf
surface with proximal vein axils sunken and hairy, forming
small pockets (domatia); thorns numerous but small (1-2
cm. long). Spring. An apomictic complex, of many named
forms, only two of which are here given recognition.
SUMMER HAW, YELLOW HAW.

Crataegus michauxii Pers.

a.Leaves broadly spatulate to obovate; branches variously
spreading, not weeping. Shrub or small to mid-sized

Phytologia (April 2009) 91(1) 25

tree. Dry to moist woodlands, fencerows, open pastures.
North Florida, south to mid-peninsula (Highlands
County); common. [Crataegus audens Beadle;
Crataegus egregia Beadle; Crataegus flava, misapplied;
Crataegus floridana Sarg.; Crataegus galbana Beadle;
Crataegus leonensis Palmer; Crataegus lepida Beadle;
Crataegus ravenelii Sarg.; Crataegus visenda Beadle]
SUMMER HAW (typical). var. michauxii

a.Leaves narrowly spatulate (except on vigorous shoots,
when sometimes broader); branches and_ branchlets
prominently weeping (pendent). Small tree. Dry
sandhills. Western half of panhandle (Escambia to
Calhoun counties); infrequent and local. [Crataegus
lacrimata Small]

WEEPING HAW. _. var. lacrimata (Small) D. B. Ward

*This paper is a continuation of a series begun in 1977. The "amplified
key" format employed here is designed to present in compact form the
basic morphological framework of a conventional dichotomous key, as
well as data on habitat, range, and frequency. Amplified keys are being
prepared for all genera of the Florida vascular flora; the present series is
restricted to genera where a new combination is required or a special
situation merits extended discussion.

26 Phytologia (April 2009) 91(1)

NEW COMBINATIONS IN THE GENUS SENEGALIA
(FABACEAE: MIMOSOIDEAE)

David S. Seigler
Department of Plant Biology, University of Illinois, Urbana, Illinois
61801, U.S.A. email: seigler@life.uiuc.edu

John E. Ebinger
Emeritus Professor of Botany, Eastern Illinois University, Charleston,
Illinois 61920, U.S.A. email: jeebinger@eiu.edu

ABSTRACT

Morphological and genetic differences separating the
subgenera of Acacia s./. and molecular evidence that the genus Acacia
s.l. is polyphyletic necessitate transfer of the following taxa from
Acacia subgenus Aculeiferum Vassal to Senegalia, resulting in 10 new
combinations in the genus Senegalia: S. grandisiliqua (Benth.) Seigler
& Ebinger, S. guarensis (L. Cardenas & F. Garcia) Seigler & Ebinger,
S. laeta (R. Br. ex Benth.) Seigler & Ebinger, S. Jowei (L. Rico) Seigler
& Ebinger, S. polyacantha (Willd.) Seigler & Ebinger, S. riograndensis
(Atahuachi & L. Rico) Seigler & Ebinger, and S. skleroxyla (Tussac)
Seigler & Ebinger. Two new combination and new status changes are
necessary: S. latifoliola (Kuntze) Seigler & Ebinger, comb. et stat.
nov. and S. rhytidocarpa (L. Rico) Seigler & Ebinger, comb. et stat.
nov. A lectotypification is made for Acacia grandisiliqua Benth. One
new name was required: S. stenocarpa Seigler & Ebinger, nom. nov.
Phytologia 91(1): 26-30,( April, 2009).

KEY WORDS: Acacia sensu lato, Fabaceae, Mimosoideae,
Senegalia.

Morphological and _ genetic differences separating the
subgenera of Acacia s./. and molecular evidence that the genus Acacia
s.l. is polyphyletic necessitate recognition of segregate genera and

Phytologia (April 2009) 91(1) 27

transfer of many Acacia species to these genera. A large number of
species of Acacia subgenus Aculeiferum Vassal must be referred to
Senegalia Rafinesque.

Taxonomic Changes

For the following 10 taxa, this results in new combinations,
changes in status and a new name in the genus Senegalia:

1. SENEGALIA GRANDISILIQUA (Benth.) Seigler & Ebinger,
comb. nov. Basionym: Acacia grandisiliqua Benth. London J. Bot. 1:
518. 1842. Bentham equated this taxon with Mimosa grandisiliqua
Vell., Fl. flumin. 11: (t. 37). 1790 [1831]. nom. nud. and made a
nom. nov. based on the type specimens below. — TYPE: BRAZIL.
BAHIA: C. F. P. von Martius 1098 [lectotype, designated here: K
(photo F)]; [paratypes: Lushnath 145 (K, MO); C. F. P. von Martius
1104 (K?)].

2. SENEGALIA GUARENSIS (L. Cardenas & F. Garcia) Seigler &
Ebinger, comb. nov. Basionym: Acacia guarensis L. Cardenas & F.
Garcia, Ernstia 10: 146. 2000.— TYPE: VENEZUELA: Territorio
Federal Amazonas. Cuenca del Rio Manapiare, selva alta, a media hora
de camino desde el poblado de Guara en direccion SE, en la pica hacia
el Cafio Garrafon, alt. 140 m, 5° 15’ N, 66° 03’ W, 28 Jan 1977, O.
Huber 429/3435 (holotype: VEN 307571).

3. SENEGALIA LAETA (R. Br. ex Benth.) Seigler & Ebinger,
comb. nov. Basionym: Acacia laeta R. Br. ex Benth., London J. Bot.
1: 508. 1842.— TYPE: ETHIOPIA: prope montes Tarnta, H. Salt 82
(holotype: BM; isotypes: MO, NY).

4. SENEGALIA LATIFOLIOLA (Kuntze) Seigler & Ebinger, comb.
et stat. nov. Basionym: Acacia riparia Kunth var. latifoliola Kuntze,
Revis. gen. pl. 3(2): 47. 1898.- TYPE: BRAZIL. MATO GROSSO:
O. Kuntze s.n. (holotype: NY).\

28 Phytologia (April 2009) 91(1)

5. SENEGALIA LOWE I (L. Rico) Seigler & Ebinger, comb. nov.
Basionym: Acacia lowei L. Rico, Amer. Sp. Acacia 114. 2007. —
TYPE: Probably from Brazil, but based on a specimen cultivated in
Madeira; [lectotype, Rico-Arce (2007): original drawing for plate 3366
(M. Young, K-library)].

6. SENEGALIA POLYACANTHA (Willd.) Seigler & Ebinger,
comb. nov. Basionym: Acacia polyacantha Willd., Sp. pl. 4: 1079.
1806.— TYPE: No type cited, habitat in India orientali, Roxburgh s.n.
[holotype: B-Willd.; isotype: (fragment K)].

7. SENEGALIA RHYTIDOCARPA (L. Rico) Seigler & Ebinger
comb. et stat. nov. Basionym: Acacia polyphylla DC. var.
rhytidocarpa L. Rico, Anales Jard. Bot. Madrid 63: 28. fig. 1. 2006.
— TYPE: BOLIVIA. BENI: Provincia Ballivian, km 35 carretera
Yucumo-Rurrenabaque, Colegio Técnico Agropecuario, rio Colorado,
67° 05’ W, 14° 50’ S, D. N. Smith et al. 13586 (holotype: LPB;
isotypes: G, K, MO).

8. SENEGALIA RIOGRANDENSIS (Atahuachi & L. Rico) Seigler
& Ebinger, comb. nov. Basionym: Acacia riograndensis Atahuachi &
L. Rico. Kew Bull. 62: 605. 2007.— TYPE: BOLIVIA.
COCHABAMBA: Provincia Campero, Pasorapa, en la bajada de
Buena Vista hacia el Rio Grande, 27 Dec 2004, /. R. I. Wood, M.
Atahuachi & M. Mercado 21251 (holotype: BOLV; isotypes: K, LPB).

9. SENEGALIA SKLEROXYLA (Tussac) Seigler & Ebinger, comb.
nov. Basionym: Acacia skleroxyla Tussac, Fl. Antill. 1: 146. (pl. 21).
1808 [1808-1813].— TYPE: Antilles. Santo Domingo [holotype: pl.
21 from Tussac (1808); isotype: K (Rico-Arce 2007)].

Phytologia (April 2009) 91(1) 29

10. SENEGALIA STENOCARPA Seigler & Ebinger, nom. nov.
Basionym: Acacia stenocarpa Malme, Ark. Bot. 23A(13): 46. 1931.
nom. illeg. non Richard (1847).— TYPE: BRAZIL. MATO GROSSO:
Corumba, in silva satis clara regionis calcariae, 19 Dec 1902, G. O. A.
Malme 2731 [lectotype, Seigler et al. (2006): S) [paratype: Malme
2731a(S)].

ACKNOWLEDGEMENTS

The authors wish to thank several colleagues for advice
concerning questions of nomenclature and general taxonomic advice.
Among these are: Fred Barrie, J. Lee Crane, K. N. Gandhi, Bruce R.
Maslin, Gordon Tucker, Paul Wilson, and James Zarucchi. The views
and conclusions (and errors) in this manuscript are our own and do not
necessarily reflect any of their judgments. We wish to acknowledge
support by the National Science Foundation (NSF DEB 04-15803) and
by the American Philosophical Society (1992).

LITERATURE CITED

Bentham, G. 1842. Notes on Mimoseae, with a synopsis of species,
London Journal of Botany 1: 318-392. 494-528.

Bentham, G. 1875. Revision of the suborder Mimoseae. Transactions
of the Linnaean Society of London 30: 335-664.

Colla, A. 1834. Herbarium Pedemontanum. 2: Torino. Ex Typis
regiis. pp. 1-557.

Richard, A. 1847 [1848]. Tentamen Florae Abyssinicae 1: Paris.
472 pp.

Rico-Arce, L. 2007. American Species of Acacia. A Checklist and
Synopsis of American species of Acacia (Leguminosae:
Mimosoideae), CONABIO, Mexico City. 207 pp.

30 Phytologia (April 2009) 91(1)
Seigler, D. S., J. E. Ebinger, and J. T. Miller. 2006. The genus
Senegalia from the New World. Phytologia 87: 38-93.

Tussac, F. R. de. 1808. Flores des Antilles, ou Histoire Generale. Vol.
1. Apud Autorem et F. Schoell, Paris. 1-198 pp.

Phytologia (April 2009) 91(1) 3]

THE LEAF ESSENTIAL OIL OF JUNIPERUS MARITIMA R. P.
ADAMS COMPARED WITH J. HORIZONTALIS, J.
SCOPULORUM AND J. VIRGINIANA OILS

Robert P. Adams
Biology Department, Baylor University, Box 727, Gruver, TX, 79040
Robert_ Adams@baylor.edu

ABSTRACT

This is first report on the composition of the leaf essential oil
of J. maritima R. P. Adams, a new juniper species from the Pacific
northwest USA. The volatile leaf oil of J. maritima is dominated by
elemicin (20.2%), sabinene (20.0%), limonene (11.7%) and 8-a-
acetoxyelemol (6.1%) with moderate amounts of safrole (3.8%),
pregeierene B (3.1%) and terpinen-4-ol (1.8%). The leaf oils of J.
horizontalis, J. scopulorum and J. virginiana var. virginiana were re-
analyzed and compared with the oil of J. maritima. Each of the four
species has a distinct oil composition reflecting their specific status.
Phytologia 91(1):31-39, (April, 2009).

KEY WORDS: Juniperus maritima, J. horizontalis, J. scopulorum, J.
virginiana var. virginiana, Cupressaceae, essential oil composition,
elemicin, sabinene, limonene, 8-a-acetoxyelemol.

Adams (1983) examined geographic variation in leaf
terpenoids throughout the range of Juniperus scopulorum Sarg. and
found that plants from the Puget Sound area of northwestern North
America showed considerable differences in their leaf terpenoids
compared with typical J. scopulorum plants in the Rocky Mountains.
Recent DNA sequencing (Schwarzbach et al, in prep.) found that the
Puget Sound plants were more related to J. virginiana L. than J.
scopulorum. As part of a continuing study of the genus Juniperus
(Adams, 2004), additional plants were collected from the Puget Sound
area and SNPs (Single Nucleotide Polymorphisms) were examined
(Adams, 2007). That study (Adams, 2007) revealed (Fig. 1) that the
junipers in the Puget Sound area also differed in their nrDNA SNPs.
Based on a combination of SNPs, terpenoids, morphology and ecology,

32 Phytologia (April 2009) 91(1)

Adams (2007) recognized the junipers of Puget Sound as a new species,
J. maritima R. P. Adams, the seaside juniper.

Although Adams (1983) reported on multivariate differences in
the oils from Puget Sound plants (now J. maritima), no information
was published on the oil composition. Because J. maritima is closely
related to J. horizontalis, J. scopulorum and J. virginiana, these leaf
oil compositions are included in this report. The leaf oil compositions
of J. horizontalis, J. scopulorum and J. virginiana have been recently
published (Adams, 2000).

PCO
18 nrDNA SNPs

J. scopulorum

J. virginiana

J. maritima

3 (6%)

Figure 1. Principal coordinate Ordination (PCO) based on 18 SNPs.
Note that J. maritima is genetically differentiated from J. scopulorum
and J. virginiana. Modified from Adams (2007).

Phytologia (April 2009) 91(1) 33

The purpose of this report is to present analysis of the leaf
essential oil of J. maritima and compare the oil with the leaf oils of the
most closely species: J. horizontalis, J. scopulorum, and J. virginiana.

MATERIAL AND METHODS

Plant material - Specimens used in this study : J. maritima:
Brentwood Bay, Vancouver Isl., BC, Adams 11056-58, Cowichan Bay,
Vancouver Isl., BC, Adams //06/-63, Yellow Point, Vancouver Isl.,
BC, Adams /1064, Lesqueti Isl., BC, Adams //065-66, Friday Harbor,
San Juan Isl., WA, Adams /1067-68, Whidbey Isl., Cranberry L., WA,
Adams 1/1075, Fidalgo Isl., Washington State Park, WA, Adams //076,
Skagit Isl., WA, Adams /1077-78; J. horizontalis: Saskatchewan River
bank, Saskatoon, Saskatchewan, Adams 1651-1660; J. scopulorum: w
bank of Animas River, Durango, CO, Adams 2010-2024; and J.
virginiana, 16 km e of Dulles Airport, Washington, DC, Adams 2409-
2423. Voucher specimens are deposited at the Herbarium, Baylor
University (BAYLU).

Isolation of Oils - Fresh leaves (200 g) were steam distilled for 2
h using a circulatory Clevenger-type apparatus (Adams, 1991). The oil
samples were concentrated (ether trap removed) with nitrogen and the
samples stored at -20°C until analyzed. The extracted leaves were oven
dried (100°C, 48 h) for determination of oil yields.

Chemical Analyses - Oils from 10-15 trees of each of the taxa
were analyzed and average values are reported. The oils were analyzed
on a HP5971 MSD mass spectrometer, scan time 1/ sec., directly
coupled to a HP 5890 gas chromatograph, using a J & W DB-5, 0.26
mm x 30 m, 0.25 micron coating thickness, fused silica capillary
column (see 5 for operating details). Identifications were made by
library searches of our volatile oil library (Adams, 2006), using the HP
Chemstation library search routines, coupled with retention time data
of authentic reference compounds. Quantitation was by FID on an HP
5890 gas chromatograph using a J & W DB-5, 0.26 mm x 30 m, 0.25
micron coating thickness, fused silica capillary column using the HP
Chemstation software.

34 Phytologia (April 2009) 91(1)

Data Analysis - Terpenoids (as per cent total oil) were coded
and compared among the species by the Gower metric (1971).
Principal coordinate analysis was performed by factoring the
associational matrix using the formulation of Gower (1966) and
Veldman (1967).

RESULTS AND DISCUSSION

The volatile leaf oil of J. maritima is dominated (table 1) by
elemicin (20.2%), sabinene (20.0%), limonene (11.7%) and 8-a-
acetoxyelemol (6.1%) with moderate amounts of safrole (3.8%),
pregeijerene B (3.1%) and terpinen-4-ol (1.8%). Several components
are found only in J. maritima: isoamyl isovalerate (t), naphthalene
(0.5), (2E,4Z)-decadienal (t), a-cubebene (t), a-humulene (t), B-
bisabolene (0.3), zonarene (t), C;;O0H (AI 1586) (0.5) and cedrol (0.1).
Most of these unique components are in trace amounts (less than
0.05%), and might be present in the other three juniper species in this
study. It is interesting that cedrol is present as it is rare in the leaf oils
of Juniperus in the western hemisphere (Adams, 2004). It is unusual
that the leaf oil of J. maritima contains such large quantities of non-
terpenoid (phenolic) compounds (elemicin, safrole).

The overall pattern of variation was determined by computing
similarity measures among the taxa and subjecting the associational
matrix to principal coordinates analysis (PCO). Figure 2 shows the
PCO ordination based on the terpenoids. Each of the sticks represents
10-15 individuals: J. horizontalis (10); J. maritima (15); J. scopulorum
(15) and J. virginiana (15). From this analysis, each oil appears
distinct. However, the oil of J. maritima appears most similar to the oil
of J. virginiana. It is interesting that J. maritima is separated by 4
SNPs from J. virginiana and 5 SNPs from J. scopulorum (Fig. 1)
similar to the pattern of leaf oils (Fig. 2).

Phytologia (April 2009) 91(1) 35

PCO Terpenoids

J. virginiana

J. scopulorum

J. maritima

J. horizontalis

Figure 2. Principal coordinate ordination (PCO) utilizing terpenoids.

ACKNOWLEDGMENTS

Thanks for field assistance from: Steve Erickson, Whidbey
and Skagit Island, WA; Eugene Kozloff, San Juan Island; Peter
Dederich, NPS, English Camp, San Juan Island, WA; Ted Smith,
Deception Pass State Park, Whidbey Island, WA; Richard Hebda,
Adolf Ceska, and John Pinder-Moss, Royal British Columbia Museum
(V); Lance Goldy, Yellow Point Resort, BC; and Drew Chapman and
Wade Calder, Lesqueti Island Ecological Reserve, BC. Thanks to
Tonya Yanke for lab assistance.

36 Phytologia (April 2009) 91(1)

LITERATURE CITED

Adams, R. P.. 1983. Infraspecific terpenoid variation in Juniperus
scopulorum: Evidence for Pleistocene refugia and recolonization in
western North America. Taxon 32: 30-46.

Adams, R. P. 2004. Junipers of the world: The genus Juniperus.
Trafford Publ., Vancouver, B.C., Canada.

Adams, R. P. 2007. Juniperus maritima, the seaside juniper, a new
species from Puget Sound, North America. Phytologia 89: 263-283.

Adams, R. P. 2000. Systematics of smooth leaf margin Juniperus of the
western hemisphere based on leaf essential oils and RAPD DNA
fingerprinting. Biochem. Syst. Ecol. 28: 149-162.

Adams, R. P. 1991. Cedar wood oil - analysis and properties. In
Modern Methods of Plant Analysis: Oils and Waxes. H. F.
Linskins and J. F. Jackson, Eds., pp. 159 - 173, Springler-Verlag,
Berlin, Germany.

Adams, R. P. 2006. Identification of Essential Oils Components by
Gas Chromatography/ Mass Spectrometry, 4th Ed. Allured Publ.
Corp., Carol Stream, IL.

Gower, J. C. 1971. A general coefficient of similarity and some of its
properties. Biometrics 27: 857-874.

Gower, J. C. 1966. Some distance properties of latent root and vector
methods used in multivariate analysis. Biometrika 53: 326-338.
Veldman, D. J. 1967. Fortran programming for the behavioral sciences.

Holt, Rinehart and Winston Publ., NY.

Phytologia (April 2009) 91(1) a

Table I. Compositions of the leaf oils of J. maritima, (marit), J.
virginiana (virg), J. scopulorum (scop) and J. horizontalis (horiz).

AI Compound marit virg scop horiz
921 tricyclene . t t -
924 a-thujene 0.6 0.2 i 0.6
932 a-pinene 0.6 1.4 4.7 Li
945 a-fenchene - - t t
946 camphene - 0.1 0.1 t
969 sabinene 20.0 6.7 46.3 3712
974 -pinene t t 0.2 0.4
988 myrcene 0.9 0.7 13 2.8
1001 6-2-carene - t - 0.1
1002 a -phellandrene - . 0.1 t
1008 6-3-carene . 0.1 0.1 0.4
1014 a -terpinene 0.7 0.3 a 0.6
1020 p-cymene t 0.1 0.5 0.4
1024 limonene 11.7 193 5.4 329
1025 B-phellandrene - - 1.0 t
1044 (E)-B-ocimene - t 0.1 OZ
1054 y-terpinene 13 0.4 1.9 V2
1065 cis-sabinene hydrate 0.5 0.3 1.4 1.3
1086 terpinolene 0.7 0.5 0.8 0.7
1187 2-nonanone - - 0.2 -
1095 linalool 0.1 4.0 0.3 0.3
1098 trans-sabinene hydrate 0.2 - 1.0 0.5
1100 n-nonanal 0.1 0.2 - t
1102 isoamyl-isovalerate t - - -
1112 trans-thujone (= B-thujone) = - - 0.1 0.1
1118 cis-p-menth-2-en-1-ol 0.3 0.4 0.4 0.4
1136 trans-p-menth-2-en-1-ol t - 0.2 0.2
1141 camphor - 4.0 0.2 0.2
1145 camphene hydrate - 0.2 0.1 ~
1148 citronellal : t - .
1165 borneol 0.1 0.7 . -
1167 umbellulone - - . t
1066 coahuilensol - 0.6 - -

1174 terpinen-4-ol 1.8 1.4 5.8 3.9

38

1178
1189
1186
1195
1195
1207
1219
1223
1249
1253
1255
1257
1274
1285
1287
1292
1314
1513
1322
1345
1350
1356
1379
1387
1403
1417
1442
1448
1452
1461
1468
1475
1478
1480
1493

1493
1500
1505

naphthalene
p-cymen-8-ol -
a-terpineol
methyl chavicol
cis-piperitol -
trans-piperitol .
coahuilensol, methyl ether -
citronellol
piperitone -
trans-sabinyl hydrate acetate -
(4Z)-decenol t
methyl! citronellate 0.2
pregeyerene B 31
safrole 3.8
bornyl acetate t
(2E,4Z)-decadienal
decadienol isomer*
(2E,4E)-decadienal t
methyl] geranate t
a-cubebene t
citronellyl acetate -
eugenol

geranyl acetate -
B-cubebene t
methyl eugenol -
(E)-caryophyllene
6,9-guaiadiene -
cis-muurola-3,5-diene -
a-humulene t
cis-cadina-1(6),4-diene -
pinchotene acetate -

trans-cadina-1(6),4-diene 0.5
y-muurolene -
germacrene D -
trans-muurola-4(14),

5-diene 1.0
epi-cubebol 0.5
a-muurolene 0.4
B-bisabolene 0.3

Phytologia (April 2009) 91(1)

= t =
ioe 08 0.2
t = =
: 0.1 t
t 0.1 0.1
0.4 : 2
2A 08 :
0.3 2 2
= t ws
O39 Oi 0.2
0.1 t :
5.) e610 :
10.0 t t
4.0 0.7 0.5
: 0.1 '
0.2 : :
t = ~
0.1 : :
t = =
t = =
52. “Ga :
t 0.1 2
: 0.2 0.2
: : 0.1
: : 0.1
0.1 5 -
: 2 t
: 0.1 0.3
t : 0.1
: 2 0.2
i 0.1 0.8
Oi 300 1.0

Phytologia (April 2009) 91(1)

[513
1513
1522
1528
1537
1549
1555
1359
1574
1586
1600
1607
1627
1630
1638
1638
1644
1649
1652
1653
1670
1685

1739
1792
1887
2055
2056
2298

y-cadinene
cubebol
6-cadinene
zonarene
a-cadinene
elemol
elemicin
germacrene B
germacrene D-4-ol
C,5OH, 43,207,161,222
cedrol
B-oplopenone
1-epi-cubenol
y-eudesmol
epi-a-cadinol
epi-a-muurolol
a-muurolol
B-eudesmol
a-eudesmol
a-cadinol
bulnesol

germacra-4(15),5,10(14)-

trien-1-al
oplopanone
8-a-acetoxyelemol
oplopanonyl acetate
abietatriene

manool

4-epi-abietal

ao

AI = Arithmetic Index on DB-5 column. Values less than 0.05% are
denoted as traces (t). Unidentified components less than 0.5% are not
reported. Those compounds that appear to distinguish taxa are in
boldface.

40 Phytologia (April 2009) 91(1)

GEOGRAPHIC VARIATION AND SYSTEMATICS OF
JUNIPERUS PHOENICEA L. FROM MADEIRA AND THE
CANARY ISLANDS: ANALYSES OF LEAF VOLATILE OILS

Robert P. Adams
Biology Department, Baylor University, Box 727, Gruver, TX, 79040

Beatriz Rumeu and Manuel Nogales
Island Ecology and Evolution Research Group (IPNA-CSIC), 38206 La
Laguna, Tenerife, Canary Islands, Spain
and

Susana S. Fontinha
Parque Natural da Madeira, CEM-UMa, Caminho do Meio 9064-512,
Funchal, Madeira, Portugal

ABSTRACT

All of the oils of J. phoenicea from the Canary Islands and
Madeira were very similar. The volatile leaf oils were dominated by a-
pinene (57.3 - 76%) as was the oil from Morocco (65.4%). This is
higher than in J. p. var. phoenicea, Spain (41.2%) or var. turbinata,
Spain, (25.8%). The Madeira and Canary Island oils had moderate
amounts of B-phellandrene (0.5 - 8.0%), myrcene (2.3 - 3.3%), a-
terpinyl acetate (trace - 5.0%), (E)-caryophyllene (0.4 - 1.4%), and
trans-totarol (0.1 - 2.1%). There is some differentiation in the oils from
Madeira and the Canary Islands from populations in Spain and
Morocco, but not enough to justify the recognition of J. p. subsp.
canariensis at this time. Phytologia 91(1):40-53 (April, 2009).

KEY WORDS: Juniperus phoenicea, Cupressaceae, Madeira Island,
Canary Islands, leaf essential oils, a-pinene, myrcene, B-phellandrene.

Juniperus phoenicea L. of the Mediterranean has red seed cones
(berries) and is the only serrate leaf margined juniper in section Sabina
in the eastern hemisphere (Adams, 2008). Gaussen (1968) discussed
several other infraspecific taxa: var. canariensis (Guyot & Mathou)
Rivas-Martinez et al., of the Canary Islands, var. /ycia (L.) Gaussen,

Phytologia (April 2009) 91(1) 4]

France littoral zone, var. mollis M & W, Morocco, and _ var.
megalocarpa Maire, dunes near Mogador, Morocco. Adams et al.
(1996) examined leaf terpenoids of J. phoenicea var. phoenicea,
Greece and Spain, J. p. var. turbinata (Guss.) Parl. (=var. oophora
Kunze), Tarifa Sand Dunes, Spain and J. p. subsp. eu-mediterranea,
west of Setubal, Portugal. Adams et al. (1996) concluded that J. p. var.
turbinata is conspecific with J. p. subsp. eu-mediterranea. There are a
number of older literature reports on analyses of the leaf volatile oil of
J. phoenicea and these are reviewed in Adams et al. (1996). The
Adams et al. (1996) study was followed up using RAPDs (Adams et
al., 2002). Figure 1 shows the PCO based on 119 RAPD bands. Note
that eu-mediterranea and v. turbinata form a cluster (lower left).
However, the plants from Tenerife, Canary Islands (cf. v. canariensis,
fig. 1) cluster closely with plants from Nea Epidavios, Greece! This
study confirmed the previous terpene analyses (Adams, et al., 1996)
that subsp. ew-mediterranea and v. turbinata are conspecific. The
plants from Corsica Island and Delphi Greece formed a separate group.

PCO 3 (14%)
119 RAPD bands

fea = v. canariensis, Canary Islands

© = v. eu-mediterranea, Portugal
& =v. phoenicea, El Penon, Spain
> = v. turbinata, Tarifa, Spain

* = Corsica Island

+x = Delphi, Greece

w= Nea Epidavios, Greece

2 (14%)

1 (27%)

Figure 1. PCO based on 119 RAPD bands ordinating various taxa of J.
Phoenicea.

42 Phytologia (April 2009) 91(1)

Most recently, Adams et al. (2006) analyzed RAPDs from J.
phoenicea from sand and rock areas in Morocco and compared these
populations with plants from Tenerife, Canary Islands and var. turbinata,
Tarifa sand dunes, Spain. PCO ordination (fig. 2) shows that 41% of the
variance in the RAPDs was due to the differences between var.
phoenicea (Spain) and the Morocco, Tenerife and var. turbinata
populations.

The Tenerife population accounted for about 14% of the variance
(fig. 2). Although, the Canary Island plants are loosely associated with
var. turbinata, they generally have large, round berries (seed cones), not
turbinate shaped.

3(14%) PCO
111 RAPD bands

J. p. var. phoenicea
Spain, 720m

J. p. var. turbinata
Tarifa sand, 30 m

2(20%)

Morocco,
940 m, rock

1(41%) Canary Islands,
150 m, lava

Figure 2. PCO ordination of J. phoenicea populations based on 111
RAPD bands.

The purpose of this study was to report on the volatile leaf oil
compositions of populations of J. phoenicea from several islands in the
Canary archipelago and Madeira, and to contrast these oils with J. p.
var. phoenicea (Iberian Peninsula, Spain) and var. turbinata (Tarifa

Phytologia (April 2009) 91(1) 43

sand dunes, Iberian Peninsula, Spain) oils. The distribution of J.
phoenicea in Madeira and the Canary Islands is shown in figure 3.

Porto Santo

° Island
Oy,

Madeira Island

J. phoenicea

Lanzarote

O

La vg Tenerife
Palma af L Fuerteventura

La
El Hierro Gomera Gran Canaria

Sahara

Canary Islands

Figure 3. Distribution of J. phoenicea in Madeira and Canary Islands.
MATERIALS AND METHODS

Plant material - J. phoenicea Madeira Island: 32° 48.822'N, 16°
52.627'W, ca 100 m, R. P. Adams 11502, 11503, cultivated at Botanic
Garden in Funchal, ex Porto de la Cruz, 32° 39.08'N, 16° 47.14'W, ca
100 m, R. P. Adams 11503; Canary Islands: Tenerife, volcanic rock, ca.
150 m, R. P. Adams 8147-8149, La Palma Island, Santa Lucia, loose
volcanic pumice, 28° 44.250'N, 17° 44.198'W, 283 m, R. P. Adams
11514-11516, La Gomera Island, volcanic rock, 28° 11.358'N, 17°
12.320'W, 370 m, R. P. Adams 11528-115230; Spain, limestone soil,
25 km e. Guadahortuna, 720 m, El Penon, R. P. Adams, 7077-7079;
Morocco, red clay, 20 km sse Marrakech, 31° 21.033'N, 07° 45.893'W,
940 m, R. P. Adams 9408-9410; Spain, J. phoenicea var. turbinata:

44 Phytologia (April 2009) 91(1)

Tarifa sand dunes, 15 km w. of Tarifa, 30 m, 36° 04.996'N, 5° 42.104'
W, R. P. Adams, 7202-7204. Voucher specimens are deposited at the
Herbarium, Baylor University (BAYLU).

Isolation of Oils - Fresh leaves (200 g) were steam distilled for 2
h using a circulatory Clevenger-type apparatus (Adams, 1991). The oil
samples were concentrated (ether trap removed) with nitrogen and the
samples stored at -20°C until analyzed. The extracted leaves were oven
dried (100°C, 48 h) for determination of oil yields.

Chemical Analyses - Oils from 10-15 trees of each of the taxa
were analyzed and average values are reported. The oils were analyzed
on a HP5971 MSD mass spectrometer, scan time 1/ sec., directly
coupled to a HP 5890 gas chromatograph, using a J & W DB-5, 0.26
mm x 30 m, 0.25 micron coating thickness, fused silica capillary
column (see 5 for operating details). Identifications were made by
library searches of our volatile oil library (Adams, 2006), using the HP
Chemstation library search routines, coupled with retention time data
of authentic reference compounds. Quantitation was by FID on an HP
5890 gas chromatograph using a J & W DB-5, 0.26 mm x 30 m, 0.25
micron coating thickness, fused silica capillary column using the HP
Chemstation software.

Data Analysis - Terpenoids (as per cent total oil) were coded
and compared among the species by the Gower metric (1971).
Principal coordinate analysis was performed by factoring the
associational matrix using the formulation of Gower (1966) and
Veldman (1967).

RESULTS AND DISCUSSION

All of the oils from the Canary Islands and Madeira were very
similar (table 1). The volatile leaf oils were dominated by a-pinene
(57.3 - 76%) as was the oil from Morocco (65.4%). o-pinene was
higher in concentration in than in J. p. var. phoenicea, Spain (41.2%) or
var. turbinata, Spain, (25.8%). The Madeira and Canary Island oils had
moderate amounts of B-phellandrene (0.5 - 8.0%), myrcene (2.3 -
3.3%), a-terpinyl acetate (trace - 5.0%), (E)-caryophyllene (0.4 - 1.4%),
and trans-totarol (0.1 - 2.1%).

Phytologia (April 2009) 91(1) 45

The oil from Morocco was the only oil with camphor (1.3%,
table 1). The oil of J. p. var. phoenicea, Spain, contained a large
concentration of manoy] oxide (22.0%). The oil of J. p. var. turbinata,
Spain, contained large amounts of fB-phellandrene (31.5%) and a-
terpinyl acetate (13.1%) along with the smallest amount of a-pinene
(25.8%).

Only two compounds seem to separate the oils of Madeira and
Canary Islands from continental oils: (E)-2-hexenal and (Z)-3-hexenol
(table 1). However, these very volatile components are easily lost
during transport and distillation, so the lack of these compounds in the
oils from Morocco and Spain (table 1) may not be so significant.

The J. phoenicea oil from Madeira shows differentiation from
the Canary Islands in having higher concentrations of B-phellandrene
(8.0%), linalool (1.0%), a-terpinyl acetate (5.0%) and a-eudesmol
(0.9%, vs. absent in the Canary Island oils, table 1). In general, these
compounds point to a similarity to the oil of J. p. var. phoenicea from
Spain.

To better understand the similarities among the oils, similarity
measures were computed and the matrix of associations was factored.
Eigenroots were extracted and accounted for 31.08, 19.50, 18.77, and
13.0% of the variance among the seven samples. The eigenroots
appeared to asymptote after the fourth eigenroot, implying that five
groups may be present. Principal Coordinate Ordination (PCO) of the
samples (Fig. 3) shows that the oils from the Canary Islands (La
Gomera, La Palma and Tenerife) are very similar (0.77 - 0.84). The
next most similar oil is from Madeira (0.73 to La Palma). The Canary
Islands oils are then linked to Morocco (0.70). Juniperus phoenicea
var. turbinata (Tarifa sand dunes, Spain) are the least similar and link
to Madeira (0.60) just smaller than the link of J. p. var. phoenicea,
Spain to Madeira (0.64). There is certainly considerable variation in
the volatile leaf oil compositions from various populations of J.
phoenicea from the populations sampled in this study. It is not clear if
there is sufficient differentiation in the Canary Islands to support the
recognition of J. phoenicea subsp. canariensis at this time.

46 Phytologia (April 2009) 91(1)

Geographic variation among the samples was further analyzed
by plotting a minimum spanning network onto a geographic map. The

2(19%) PCO
50 terpenoids

Morocco

‘La Palma var. phoenicea
so he

B4-[] o>.
Tenerife - ; =
Madeira

*

th
La Gomera .-*

'60 @» Var. turbinata
Spain

Figure 4. PCO ordination based on 50 terpenoids with the minimum
spanning network super-imposed.

samples from the Canary Islands are, geographically, the nearest
neighbors and their oils high similarities reflect the co-differentiation
and genetic isolation of the Canary Islands from Africa and Madeira
(ig, 5):

However, the linkage of the Canary Islands populations to
Madeira is larger than its linkage to Africa (fig. 5). This may reflect
more gene flow from north - south bird migrations (and seed cone
dispersal) than from the east-west bird migrations to Morocco.

Phytologia (April 2009) 91(1) 47

Alternatively, the linkage to Madeira may reflect co-evolution in
similar climates of the Canary Islands and Madeira.

J. phoenicea
Minimum Spanning
Network

50 terpenoids

Madeira

Lanzarote

~ o/ p Fuerteventura
oO
on oO)

El Hierro Gomera Gran Canaria

Western
Canary Islands Sahara

Figure 5. Minimum spanning network based on 50 terpenoids.

ACKNOWLEDGMENTS

Thanks to whose helped us collect in the islands (Félix M.
Medina- La Palma, Angel Fernandez - La Gomera, Paulo Moniz -
Madeira Island). This research was supported in part with funds from
Baylor University and the project 80/2005 from the Organismo
Autonomo de Parques Nacionales, Ministerio de Medio Ambiente of
Spain.

48 Phytologia (April 2009) 91(1)

LITERATURE CITED

Adams R. P. 1975. Statistical character weighting and similarity
stability. Brittonia 27: 305-316.

Adams, R. P. 1991. Cedar wood oil - analysis and properties. In
Modern Methods of Plant Analysis: Oils and Waxes. H. F.
Linskins and J. F. Jackson, Eds., pp. 159 - 173,

Springler-Verlag, Berlin, Germany.

Adams, R. P. 2006. Identification of Essential Oils Components by
Gas Chromatography/ Mass Spectrometry, 4th Ed. Allured Publ.
Corp., Carol Stream, IL.

Adams, R. P., 2008. Junipers of the world: The genus Juniperus. 2nd
Ed., Trafford Publ., Vancouver, B.C., Canada.

Adams, R. P., A. F. Barrero and A. Lara. 1996. Comparisons of the
leaf essential oils of Juniperus phoenicea L., J. phoenicea subsp.
eu-mediterranea Lebr. & Thiv. and J/. phoenicea var. turbinata
(Guss.) Parl. J. Essent. Oil Res. 8: 367-371.

Adams, R. P., S. Nguyen and N. Achak. 2006. Geographic variation in
Juniperus phoenicea (Cupressaceae) from the Canary Islands,
Morocco and Spain based on RAPDs analysis. Phytologia 88(3):
270-278.

Adams, R. P., R. N. Pandey, Serge Rezzi and Joseph Casanova. 2002.
Geographic variation in the Random Amplified Polymorphic DNAs
(RAPDs) of Juniperus phoenicea, J. p. var. canariensis, J. p. subsp.
eu-mediterranea, and J. p. var. turbinata. Biochem. Syst. Ecol. 30:
223-229.

Gaussen, H. 1968. Les Cupressacees Fasc. X in Les Gymnospermes,
Actuelles et Fossiles. Lab. Forest, Univ. Toulouse, France.

Gower J. C., 1971. A general coefficient of similarity and some of its
properties. Biometrics 27, 857-874.

Gower J. C., 1966. Some distance properties of latent root and vector
methods used in multivariate analysis. Biometrika 53, 326-338.

Veldman D. J., 1967. Fortran programming for the behavioral
sciences. Holt, Rinehart and Winston Publ., NY.

49

Phytologia (April 2009) 91(1)

10 0'l £0 } } v0 0'l ¥Oojeul] §=C60I

8" L'0 ‘ 90 9°0 90 Ol ,ousjourdss} 980]
. 3 01 : } } 1 ,ouoyousy EOI
£0 70 r'0 £0 50 £0 £0 suouldiay-A pS
} . 10 10 70 £0 guowis0-g-(q) prdl
SI€ 6 9°0 $0 el vl 0'8 ,auaipueyayd-g S701
} 90 60 90 6'| 6'I 60 ,ousuoul| PZ 1
Cl b'0 90 €0 €0 10 50 ,ouswAo-d (701
£0 10 10 } } 10 10 ,ousuidia}-0 pI 01
- sl €7 } ) €'0 ,9U91BI-€-2 800
rr L'0 : = : = Vl ,suaipuelyjayd-9 7001
50 10 70 } 10 } 10 gude9-7-2 1001
9°9 ra be Sat 6 87 Lt €€ ,IUIIIAW —- BBG
Cl be 8°0 ci rl 9'1 ol ,ououid-g = 7L6
} 10 70 } } b'0 70 qusUIges 696
| 10) £0 - - - - - JUDUSGIOA 196
: 10 50 70 10 10 70 ,ousip-p'Z-einyy = €S6
70 10 90 50 50 ¢'0 £0 suoydues = 96
} 10 (Gi) } 10 10 10 qudYyoUgj-D CHG
8°SZ TIP r’s9 €Ls 0'9L 6°L9 SLs ,ouauld-D = 7€6
10 10 £0 10 70 70 10 susjoA0Iy 176
= é - €'0 70 10 jousxay-¢-~(Z) OS8
= £0 } 1 70 jeuoxoy-7-(q) 8

DIDUIgAn] UIedG ODIO] BIOWIOH eT eujeqey slouay eilope| punoduio0,

‘uredg ‘eyuey ‘ojpuigin) “1eA vagiuaoyd ‘7 pur uledg pur 09010
wos pagiuaoyd ‘f YM poreduiod BIOWOH eT pue eU[ed BT “oyous] -Spue|s]
Areued oy) pur enopeyy Woy vaoiuaoyd ‘f JO S|l0 Jeo] BY} JO uotIsodwoyd “| 9194eL

gia (April 2009) 91(1)

Phytolo

50

pIpUIgAn] WledG Odd0IO| PIOWIOD V7]

Bue eT]

dyloua |,

BIlOpey

yeusyAu

joyuadid-sio

x[09utd19)}-0

[O-g-uawA9-d

ouayeyyydeu

[0-p-usuidia}
auoydwiesouid-sio
[0-g-uaIp-¢* | -eyjusw-d

4 [O9UIOG

ouoAresould
,ouoyduesouid-suedy
josajnd-osi

[e][oUoII9

,loydues

4 [OUIGIIA-SUP.}

«CS 1S618°SS' TP “HO"'D
]OUIGIDA-SI19

4 [OdAreo0uld-sue.y
(ploueiny) Oprxo 9udUOWII]-SI9
OPIXO dSO1-suR}

4 [eusjoyduies-0
ouousyjuRsAIyo

4 |O- [-U9-7-YyyUoUI-d-si9
joysuaj-opuad

OPIXO ISOI-SI9

jeueuou-u
joojeul|
punodwio,

S6ll
S6ll
98I1
6LI1
8ZL11
vLil
CLI
SOL
SOL
O9TT
8SI1
SSIl
Srl
Irll
Ori I
6e11
fay ai)
Sell
cell
cell
CCl
(GA '
SIT
VIII
9011
OOLI
S601

IV

51

Phytologia (April 2009) 91 (1)

E 10
Vel 10
8°0 4

= }
€0 €0
av 5
c0 ‘
80 F
SO ray)
t0 c0

10 ;

: 10
9°0 S0
10 x

} 10
£0

= (av

. 10

DIpUIgAN] Uredg” Osd0IOJY_ PIOUIOH eT] euleg eT]

10

v0

ayWOUS |,

a DUdWID]9-] GRE]
s auaqgoqno-q gE]

= auduoqginog-J LE]
: ausedoo-0 =p ¢]

0’s x9)ej998 [AUICII}-D OPE]
= suaqgoqno-0 CprEe]
- SII16'6S‘PEl ‘Eb HO"'D IPel
= SUDUZ[9-Q CEE]
2 jeusipesop-p°7-(AA) «SIE I
<i JOWOS!I [OUSIPBIDP GONE]
: jeusipesop-p7-(Z"A) 7671

- (prouesAd)
9}8]99B SPIXO [OO]RUI|-SUR /8Z|
0 ayejoor JAUIOG = L87ZI
70 yorejaoe [ASajndosi-osu = p17]
: joussap-(Ap) 6STZ1
L0 «|0U999P-(Zp) SSTI

- auoyodid §=6pZ]
: ayejooe |AUYURSAIYS-SUR] CET]
. ouosaind § ¢¢Z]
. Joyja [Ayo ‘jouxyy 7 ET]

10 JO[JOUOTIS = ETI
} aye]990e [AYOUDJ-Opud = BIZ]
10 JOoAIeO-suRI] §S{Z]

- joyiodid-suey 07]
€0 x UOUSGISA = HOT
10 jousyAW C6] |
BIlOpey punodwio, IV

= 10 Ol
= Z'0 Z'0
= - }
= Z0 9°0
S 9°0 "1
2 10 01
S. = =
< : :
3 - :
= : :
S v0 Z0
ant 5 P
= 10 10
10 €0
10 ;
10 -
70 $0
10 rea |
- Z0

pypuigany ureds

52

10 L0 c0 £0 10 xl] 9pixoda ouajnuiny —g09|

90 tl v0 50 70 42PIxo auat[AydoAres = 7 gC]
10 90 £0 70 50 #10-p-G-suarseuIas =p S|
60 - - ; #lOpljorsu-(q) [9S]
- - - - - x OUdIDRUWIOS «= 6 SS]
L'0 10 10 10 £0 x[OW3[2 SPST
. - - = «POT T9OT'SOL69 TR HOD = SEST
: 70 ra) 70 a QudIp-p*|-BUIpeo-suel) EEC]
v0 - - - - JUSUSWIP]B9O-SID TEs]
z a) : ¢'0 < JOplorsu-Z TES]
TO - } - = QUdIBUOZ 8TSI
I'l = 80 : = 4OUIUIPeI-Q ZG]
3 9°] : 9°] 50 ,ouauipes-A ETS]
v0 61 Vl (ult £0 #10goqnd §¢1¢]
10 : - = : O77 IO I8'SSTRHOS'D 6051
£0 r'0 10 £0 a) suajoinnui-0 QOS]
- = = - - auoydiowre-A C6p]
v0 > 50 90 70 xlogoqno-Ida_ ¢6p]
$0 | $0 ZI 10 ausip-¢‘(p])p-PfomnNwu-suey Ep]
= = = - - 4 UdIDVULIOS «= PRP]
50 = 10 - 10 sugjomnnu-A —8/ pT
r'0 90 £0 90 : ,0UdIp-p'(9) [-euIped-sue CLP]
70 i r'0 90 L0 ,ougnumny-0 = 7Sp]
£0 90 £0 50 } ,OUIIP-¢*¢-RJOINNU-SID pp]
70 } } } 70 suasdofnyj-sio 67P]
80 pl v0 90 60 ,oua|[AydoAres-(q) LIP l
10 ; - suouldisuo]-g O0rI

OOOIOY eIOWMIOH eT euljeg ey] ojouoy ellopeyy punodui0, IV

33

gia (April 2009) 91(1)

Phytolo

‘“g0eJpjoq ul aie exe} ysinBuljsip 0} Jeadde yeu) spunodwo9s
asoy] ‘payodai jou ase %G'O UeU} SSa| S}JUaUOdWOD payUapIUp *(}) Sede1} Se pajoUep ae %1'9
ueY} SS9| SaNjeA jeuoNisodwog ‘sasAjeue jedJawWNU Ul pasp, ‘ULUN|OD G-gq UO xEpuUy OEWUIWY = |V

c0 20
: c0
LO LO
} LO
? LO
v0 0°22
LO LO
. cl
80 Gb
: LO
. LO
£0 £0
Z0 £0
c0 v0
c0 LO
LO c0
LO c0
€0 v0

LO
LO
LO
LO
92

c0
Oc
v0
v0
€0

LO
c0

v0
c0
}

ejyeuiginy uledS Odd0I0/y eJAWOS e] Cujeg e] ajoue] elope

Z0 joulBhns9aj-sues}
Le ,|012}0}-SUBL}
y'0 |eyaiqe-ida-p
v0 susipeyaige
€0 susijejaige

- joouew

; apixo |Aouew-¢ 1 -Ida
: x29pixo |Aouew
SUSIP-G}

‘(p1)g-esewidooesepues

- .lOSewej-(49‘ZZ)

Ol lounqoAys
9°0 [>| -Udtd}
-(pL)OL‘S‘(SL)p-essews9b6

- josaujng
- ,JOUIped-D
60 ,[OWsapne-p
Z0 jousapne-g
- jouaqno
€0 jOjounnWw-p-Ida
Z0 |Oulpeo-p-Ida
- jowsapne-A
v0 .022'70Z'191'6LL Eb ‘HOD

punodwioy

LEE?
VLETS
8622
2802
GS0Z2
9502
6002
8L6L

8961
SLLZL
889L

S89L
OL9L
ZS9L
cS9OL
6v9l
SV9L
8E9l
8e9l
O€9L
Gc9OL

54 Phytologia (April 2009) 91(1)

SCHRADERANTHUS, A NEW GENUS OF SOLANACEAE

John E. Averett
Department of Biology, P.O. Box 8042
Georgia Southern University, Statesboro, GA 30460 U.S.A.
averett@georgiasouthern.edu

ABSTRACT

Saracha viscosa Schrader, of Mexico and Central America,
has been positioned in a variety of genera since it was first described,
most notably Athenaea, Jaltomata and Leucophysalis. Arguments are
presented for the exclusion of the taxon from those genera and tis
recognition as a new genus, Schraderanthus.

Phytologia 91(1):3-17 (April, 2009).

KEY WORDS; Solanaceae, Athenaea, Chamaesaracha, Jaltomata,
Leucophysalis, Physalis, Saracha, Witheringia, Mexico.

A Mexican and Central American species that in most recent
literature has been treated as Athenaea viscosa or Leucophysalis viscosa
has been placed in seven different genera since its description as
Saracha viscosa in 1832. It also was treated as a species of Physalis,
requiring a new specific epithet because of the earlier name, P. viscosa
L. Saracha viscosa was described from plants grown from seeds
collected in Mexico but the species extends into Guatemala. Current
data and generic concepts provide strong support for the recognition of
this problematic species as a new monotypic genus. While the single
species concerned is reasonably well-known, the following synopsis is
provided.

Schraderanthus Averett, Gen. nov.

Herbae vel frutices usque ad 1-2.5 m altae; inflorescentiae fasciculatae
axillares; calyx accrescens fructificans campanulatus, basi rotundatus,
lobis 5 aequalibus, ad apiceum acutis, in fructu maturo campanulato-
retrorsis, baccam rubro-aurantiaca, 10-15 mm diametro; semina ca 50-
75.

Phytologia (April 2009) 91(1) 55

Erect herbs or soft-wooded shrubs 1.0-2.5 m tall, viscid,
glandular-pubescent; inflorescences fasciculate with 6-8 (-10) flowers
per axil, corolla 5-lobed with greenish maculations in the throat, ca 4
cm in diameter, rotate; anthers bluish (drying to a yellow-green), the
filaments inserted at the base; flowering calyx accrescent, exceeding
the length of the corolla, deeply lobed to ca % the length of the calyx,
lobes acute; fruiting calyx broadly campanulate, deeply lobed,
exceeding the berry but becoming reflexed at maturity, exposing the
berry; berry bright red to orange-red, seeds ca 50-75, reniform, brown,
ca 2 mm long, the testa rugose-reticulate.

The most distinctive aspects of this novel genus are the 6-8
flowers in fascicles, as opposed to 1-2 per axil in some related genera
and the bright red to orange-red berries surrounded by an accrescent
calyx which initially loosely envelops the fruit and then opens into a
broad campanulate to reflexed structure beneath the berry. These are
features unknown in any of the genera to which the entity has been
previously aligned. The nature of the calyx, in particular, is not always
captured on dried specimens (including the type), and is not illustrated
by Hunziker (2001), but is well illustrated in the Flora de Veracruz
(Nee, 1986).

The genus is named for Heinrich Schrader who first described
the species concerned.

Type species: Schraderanthus viscosus (Schrad.) Averett, Comb. nov.

Basionym: Saracha viscosa Schrader, Index Seminum [G6ettingen]
5. 1832. TYPE: Cult., Hort. Géettingen, Schrader s.n. (MO, not seen;.
phototype seen on TROPICOS).

Synonymy:

Physalis schraderiana Bernh., Linnaea 13: 361. 1839.

Witheringia viscosa (Schrad.) Miers, Ann. Mag. Nat. Hist., ser. 2,
11(62): 92. 1853

Athenaea viscosa (Schrad.) Fernald, Proc. Amer. Acad. Arts 35: 567.
1900.

56 Phytologia (April 2009) 91(1)

Jaltomata viscosa (Schrad.) D'Arcy & Til. Davis, Ann. Missouri Bot.
Gard. 63: 363. 1976[1977].

Leucophysalis viscosa (Schrad.) Hunz., Kurtziana 21: 283. 1991.
Chamaesaracha viscosa (Schrad.) Hunz., Lorentzia 8: 8. 1995.

Complete descriptions of the species are provided by D’Arcy
(1976) as Jaltomata viscosa, and as Leucophysalis viscosa (Hunziker,
2001). The species is also described as Athenaea viscosa in the Flora
of Guatemala (Gentry and Standley, 1974) and in Spanish in the Flora
de Veracruz (Nee, 1986). It is a very distinct species and unlikely to be
confused with anything else except, perhaps, Brachistus nelsonii
(Fernald) D’Arcy, J. Gentry & Averett and further description does not
seem required. Schraderanthus viscosus occurs in the Mexican states
of Chiapas, Oaxaca and Veracruz and extends into Guatemala. The
location in Veracruz is from cited material (Nee, 1986); the later notes
that the species as rare and little-known in Veracruz.

ADDITIONAL SPECIMENS: GUATEMALA: Baja Verapaz: Union
Barrios, west of km 154 on the Coban road, 12 Apr 1975. Lundell &
Contreras 19171 (LL); MEXICO: Chiapas, Mpio. La Independencia,
logging road from Las Margaritas to Campo Alegre, 2300 m, 18 Feb
1973, Breedlove 33631 (NY, TEX); Oaxaca, Distr. Mixe, 2 km N de
San Miguel Metepec, 8 Apr 1984, Torres & Martinez 4967 (LL);
Oaxaca, ca 6 km S of Totontepec, 18 Feb 1992, Panero & Campos
2761 (TEX); Distr. Ixtlan, Mpio. Santiago Comaltepec, Soyalapan, 100
m, 17°45’N, 96°30’W [imprecise], 16 May 1988, E. Lopez G. 120
(NY); Distr. Ixtlan, Sierra de Juarez, camino de Calpulalpan a Llano
Verde, 12 km al NO de Calpulalpan, 2500 m, 29 May 1983, Lorence &
Cedillo 4195 (NY); Sierra Mazateca, Mpio. Mazatlan Villa de Flores,
San Pedro de los Encinos, 18°04’05.3”W, 96°52°41.9”"W, 2325 m, 23
Apr 2002, X. Munn-Estrada & Mendoza 2263 (NY); 50 km S de Valle
Nacional, sobre la carretera a Oaxaca, 2250 m, 28 Jun 1975, Rzedowski
33382 (NY); Distr. Mixe, 5.2 km NE de la desviacion a Zacatepec,
2380 m, 23 Apr 1983, Torres & Cedillo 2680 (NY); Distr. Mixe, 7 km
NE de la desviaciodn a Zacatepec, 2380 m, 23 Apr 1983, Torres &
Cedillo 2697 (NY); Distr. Villa Alta, 11.7 km N de Maravillas a 39.7
km al N de Zoogocho, 2020 m, 15 May 1983, Torres et al. 2938
(NY); Distr. Mixe, 20 km N de Yacochi, camino a San Andrés Yaa,
2290 m, 8 Aug 1985, Torres et al. 7108 (NY). Veracruz, Mpio.

Phytologia (April 2009) 91(1) 57

Atzalan, La Calavera, Carretera Altotonga-Tlapacoyan, Chdzarp &
Dorantes 94 (ENCB). U.S.A. Massachusetts: “Hort. Cantab.”
[Botanical Garden at Cambridge, Harvard University], 1849, 4. Gray
s.n. (NY). Missouri: St. Louis Co., St. Louis, cult. by W. G. D’Arcy for
the Second International Solanaceae Conference (“780425-2”), 6 Aug.
1982, M. Nee 25507 (NY); Switzerland. HBBasil [Botanical Garden at
Basil], 29 Jun 1863, s.c. s.n. (NY).; Australia. South Australia:
Southern Lofty Region, Tusmore (suburb of Adelaide), pot grown,
provenance unknown, | May 1991, D. E. Symon s.n. (NY).

DISCUSSION

Saracha was once broadly construed to include a group of
herbs widely distributed throughout Mexico, Central and South
America that are now generally referred to Jaltomata (Gentry, 1973).
Saracha is now recognized as a small genus of two species occurring at
high elevations in South America with broadly or narrowly
campanulate corollas and non or minimally accrescent calyces; it is part
of a complex of several woody, mostly Andean genera, including
Iochroma, Dunalia and Acnistus (Smith & Baum, 2006).

D’Arcy and Davis (D’Arcy, 1976), following Gentry’s
restoration of the genus Jaltomata and recognizing the species as
separate from Saracha, transferred the species to the former as
Jaltomata viscosa. He acknowledged, however, that its placement
within Jaltomata was problematic. D’Arcy provided an excellent
account of its history, with an expanded description of the taxon.
Between the original description of Saracha viscosa and its transfer to
Jaltomata, the species, besides to Physalis, had been assigned to
Witheringia and Athenaea which, as constituted today, differ in a
number of floral features and are clearly separate.

Subsequent to the work of D’Arcy and Davis, Mione (pers.
comm.) grew and became familiar with the species in question. Mione
noted that the taxon has red fruit, which are absent in all Mexican
Jaltomata; because of this, and characters of the fruiting calyx, he
rejected placement of the species in Ja/tomata. Molecular studies
(Mione et al., 1994) provide strong additional support for exclusion of

58 Phytologia (April 2009) 91(1)

S. viscosus from that genus. Jaltomata possesses umbellate
inflorescences which are not present in Schraderanthus, and the
accrescent calyx is spreading in fruit.

Hunziker (1991) transferred Jaltomata_ viscosa _ to
Leucophysalis and subsequently (1995) to Chamaesaracha. In his
Genera Solanacerum (2001), Hunziker returns the species to
Leucophysalis, where he notes that the systematic position of the
species has been in dispute and assigned to six different genera, mostly
without explanation, which, it seems, would include his own transfers.
Hunziker also notes the peculiar disjunctions within Leucophysalis.
Leucophysalis grandiflora, the generiotype, has the northernmost
distribution of any North American Solanaceae, while L. viscosa is
neotropical.

The characters that distinguish Schraderanthus from
Jaltomata also distinguish it from Leucophysalis and Chamaesaracha.
Excepting two doubtful species of sect. Capsicophysalis of the latter,
red fruit are absent in Chamaesaracha and Leucophysalis. The flowers,
with the broken green maculations at the base of the petals and
distinctly lobed margins, also differ. Further, the wide disjunction
between L. grandiflora and Schraderanthus and suggests a different
origin.

Whitson and Manos (2005) conducted a two-gene analysis
from selected physaloid species that showed a close relationship
between Leucophysalis grandiflora and L. nana, and a distant
relationship between both species and Schraderanthus viscosus. A
phylogenetic analysis of morphological characters by Axelius (1996)
provided some evidence for a closer relationship between L.
grandiflora and S. viscosus, but additional analyses of fruit and calyx
characters of the fruit would be useful. Unfortunately, there are few
phylogenetic analyses that include S. viscosus and the two species of
Leucophysalis. In short, Chamaesaracha, including the type, C.
coronopus, is Clearly a distinct assemblage.

Gentry (1974) treated S. viscosus as Athenaea viscosa and
noted that it to be morphologically similar to a group of Physalis
species that have a 5-lobed corolla and mostly several flowers from

Phytologia (April 2009) 91(1) 59

individual axils, but lacking the inflated fruiting calyx. A similar
observation was made by Nee (1986) and Mione et al. (1994).

Schraderanthus may be most closely related to Brachistus,
Darcyanthus, and one or two species Hunziker (2001) have been
treated as Chamaesaracha sect. Capsicophysalis,; all have red or
orange-red fruit and share other characters (Table 1). However, lacking
any clear evidence that any are congeneric, it seems most appropriate to
recognize Schraderanthus as and distinct genus. Table | summarizes
the salient characters of Schraderanthus and closely related genera.

ACKNOWLEDGEMENTS

I am grateful to Drs. Robert Hattaway, Thomas Mione, and Michael
Nee for critical reviews of the manuscript. Dr. Mione also shared
photographs and alcohol-preserved material of Schraderanthus which
were especially helpful in understanding the floral and fruiting
characters. Specimens were borrowed from the University of Texas
Plant Resources Center (LL, TEX). Dr. Nee provided localities and
other label data for the specimens at New York Botanical Garden (NY).

Phytologia (April 2009) 91(1)

60

usai6 ‘Aujaq ou} uaa ‘Auiaq 3u}
usaJ6 ‘Aaq Buisojous Ajjemed BHulsojous Jo Ajjemed pou ‘Ayunyeuw
au} Bulsojoue pue 0} pue Burssaidde pue Bulssaidde ye Auiaq ay} Japun
pessaidde ‘jusosas00V/ Ajasojo ‘jusoSaID0V Ajasojo ‘jJuasoses00y + = Bulxayjas ‘Juadsas00y xAjeo Buljini4

Ausaq Aysaly ‘pay Auiaq Ap ‘uaaig Assaq Aysal ‘uaaig Ausaq Aysal ‘pay wn

pepyed-c peped jou ‘peqo|-g aijua Ajweou suibsew payed 0} paqo|-s
‘gyejnuedwed Ayyybijs ‘ayeyoy ‘paqo] aj}}!| ‘aJe}ON += ‘Paxayas pue 9}ejOY B||O10D

sjixe siixe sjixe sjixe
woud ‘ajejnoiose WO} SIOMO|} Z JO | WO} SIBMO|J Z JO | WwOd) ‘ajejnoiose4 |sdUadSaJ0}U|

quay quay jejuudsed/jenuue
$90} ||eWS40 jeluugied Bulpeaids = jejuuased Hulpeoids ‘snosoeqiay
sqniys }oeJ9 Jo Bulpusosy JO jenuue ‘yoo19 Jo Apoom ‘jas
—— <a GiIEeSormGlosiios . =. ne. =. eS ae

snjsiyoelg eyoesesaeweyy sijesAydoone7 snyjuelapelyos

‘elouob pajejai pue snyjUesapesyIS jo SsayOeseYyo Jo uOSUedWOD “| aGeL

Phytologia (April 2009) 91 (1) 61

LITERATURE CITED

Axelius, B. 1996. The phylogenetic relationships of the physaloid
genera (Solanaceae) based on morphological data. Amer. J.
Bot. 83: 118-124.

D’Arcy, W. G. 1976 [1977]. New names and taxa in the Solanaceae.
Ann. Missouri Bot. Gard. 63: 363-369.

Gentry, J. L. Jr. 1973. Restoration of the genus Ja/tomata
(Solanaceae). Phytologia 27: 286-288.

Gentry, J. L. Jr. and P.C. Standley. 1974. Solanaceae in Flora of
Guatemala. Fieldiana: Bot. 24: 1-151.

Hunziker, A. T. 1991. Nota preliminar sobre Saracha viscosa
Solanaceae y su significado taxonomico. Kurtziana 21: 283.

Hunziker, A. T. 2001. Genera Solanacearum. A.R.G. Gantner Verlag
K.-G., Ruggell, Germany.

Mione, T., R. Olmstead, R. Jansen, and G. J. Anderson. 1994.
Systematic implications of chloroplast DNA variation in
Jaltomata and selected physaloid genera. Amer. J. Bot. 81: 912-
918.

Nee, M. 1986. Solanaceae I, Flora de Veracruz. Fasciculo 49. Instituto
Nacional de Investigaciones sobre Recursos Bioticos, Xalapa,
Veracruz Mexico.

Smith, S. D. and D. A. Baum. 2006. Phylogenetics of the florally
diverse Andean clade Iochrominae (Solanaceae). Amer. J. Bot.
93:1140-1153.

Whitson, M. and P. Manos. 2005. Untangling Physalis from the
physaloids: a two-gene phylogeny of the Physalineae. Syst. Bot.
30: 216-230.

62 Phytologia (April 2009) 91(1)

POINT OF VIEW
AUTHORS’ INITIALS IN SCIENTIFIC NAMES WITH
MULTIPLE AUTHORITIES

Guy L. Nesom
2925 Hartwood Drive, Fort Worth, TX 76109
www.guynesom.com

An authority is added to a scientific name to provide clarity in
the identity of the taxon by indicating its nomenclatural history. Names
of botanical authorities in abbreviated form have been used since the
Linnaean era to make scientific names less cumbersome, and Brummitt
and Powell (1992, Authors of Plant Names, Royal Botanic Gardens,
Kew) have provided a guide toward standardization of authors’ names,
including abbreviated forms. Phytologia 91(1):62-63 (April, 2009).

To differentiate between botanical authorities when two or
more phytographers have the same last name, addition of initials for
many authors has become widely accepted (even required) in current
publication. Different botanists are contrasted in “DC.” (Augustin
Pyramus de Candolle) vs. “A. DC.” (Alphonse Louis Pierre Pyramus de
Candolle), “A. Gray” (Asa Gray) vs. “Gray” (Samuel Frederick Gray),
and “S.F. Blake” (Sidney Fay Blake) vs. “Blake” (Joseph Blake).

As a single authority, “B.L. Turner” justifiably includes
initials because more than one Turner has been a phytographer. On the
other hand, reference to B.L. Turner is unequivocal in “Aphanostephus
ramosissimus var. ramosus (DC.) Turner & Birdsong” because no other
combination of these names exists in botanical history. Similarly,
Gutierrezia pomariensis (S.L. Welsh) S.L. Welsh is appropriate, but
initials for the parenthetical Welsh are unnecessary in Gutierrezia
petradoria (Welsh & Goodrich) S.L. Welsh. In uncommon instances
where there might be confusion about the precise identity of one
authority among others in a multiple authority, online resources usually
enable one to quickly view the entire citation for a scientific name’s
publication, including the author’s full name or names (with initials)
and, in many cases, even the text of the entire publication.

Phytologia (April 2009) 91(1) 63

Full citation of authorities with initials is appropriate to dispel
ambiguity in the protologues of new taxa and in new combinations.
But rather than adding critical clarity to the identity of the taxon,
additions of initials in citations of multiple authors such as _ the
following load up text with unnecessary and ponderous details:

Abronia bolackii N.D. Atwood, S.L. Welsh, & K.D. Heil

Antennaria dimorpha (Nutt.) Torrey & A. Gray

Xanthisma spinulosum var. chihuahuanum (B.L. Turner &

R.L. Hartm.) D.R. Morgan & R.L. Hartm.

Those names are cited more readably and with equal clarity as the
following:

Abronia bolackii Atwood, Welsh, & Heil

Antennaria dimorpha (Nutt.) Torrey & Gray

Xanthisma spinulosum var. chihuahuanum (Turner &

Hartman) Morgan & Hartman
And because each of these names has been used only once, the taxa
concerned also are identified with complete unambiguity by the
following:

Abronia bolackii

Antennaria dimorpha

Xanthisma spinulosum var. chihuahuanum

Format in the Flora of North America North of Mexico
volumes requires that all author citations are maximally formal, with
last names in completely unabbreviated form. In general, however,
insistence on extended forms of author citations in all situations seems
unnecessary, especially where brevity and easy comprehension are
concerns.

I greatly appreciate comments and suggestions for clarification from
John Strother and Jim Reveal, but the little plaint registered here is
mine, not theirs.

64 Phytologia (April 2009) 91(1)

NOTES ON THE TAXONOMY OF MAYTENUS
PHYLLANTHOIDES (CELASTRACEAE)

Guy L. Nesom
2925 Hartwood Drive, Fort Worth, TX 76109
www.guynesom.com

ABSTRACT

Maytenus phyllanthoides var. ovalifolia Loes. (= M. texana
Lundell) of southern Texas and adjacent Tamaulipas, Mexico, is
considered here to be a distinct entity appropriately treated at varietal
rank. They differ from typical plants in their oblong-elliptic to
obovate-elliptic, short-petiolate leaves rounded at the base and their
consistent tendency to grow as prostrate shrubs.

Phytologia 91(1):64-68 (April, 2009).

KEY WORDS: Maytenus phyllanthoides, M. phyllanthoides var.
ovalifolia, M. texana, Texas

Maytenus phyllanthoides occurs widely in coastal and near-
coastal Mexico—along the Gulf and Pacific coasts—as well as saline
sites in some inland areas (e.g., Coahuila, Nuevo Leon, Puebla,
Hidalgo, Querétaro). It extends eastward to Cuba, the Bahamas, and
Florida, where it occurs in 10 peninsular and Keys counties (Wunderlin
& Hansen 2008). A closely similar form occurs in five counties of
southernmost Texas (Turner et al. 2003)—along the Gulf Coast in both
areas.

Over its whole range, plants of typical Maytenus
phyllanthoides are erect shrubs to small trees 1-3 meters tall,
monoecious with unisexual flowers. The leaves are coriaceous,
evergreen, and obovate with entire margins, rounded apices, and long-
tapering, straight-sided bases.

The Texas populations were described in 1939 as Maytenus
texana Lundell; the same population system had been named in 1910 as
M. phyllanthoides var. ovalifolia Loes., based on a collection from

Phytologia (April 2009) 91(1) 65

immediately adjacent Tamaulipas, Mexico. Lundell (1939, p. 307)
noted that “The oblong-elliptic or obovate-elliptic, short-petiolate
leaves rounded at the base, and the smaller rufous-punctate flowers
distinguish M. texana from M. phyllanthoides Benth., its closest
relative. In the latter, the leaves are obovate, cuneate at the base, larger,
and have much longer petioles.” Loesener’s diagnosis described the
same leaf morphology later noted by Lundell as characteristic: “Foliis
ellipticis vel ovalibus vel obovatis basi rotundatis vel obtusis neque
cuneatus a typo recedens.” The difference in leaf shape between
typical M. phyllanthoides and the variants is confirmed here and a
distinction in growth habit also is evident.

Correll and Johnston (1970) described the species in Texas as
‘““A much-branched spreading or prostrate shrub,” and various collectors
have made similar observations.

Correll 38283 (TEX): “creeping on ground and forming low
shrubs”

Correll & Johnston 17955 (LL): “repent or widely decumbent shrub
forming growths 2-4 ft. in diameter”

Correll & Wasshausen 27676 (LL, MO): “sprawling on ground”

Cory 54601 (LL): “shrub 3 dm. high or less”

Ertter 5242 (TEX): “spreading to prostrate”

Lundell 1255 (MO): “shrub up to 2 m high, erect or prostrate,
rooting at the nodes of prostrate branches”

Lundell 10708 (LL): “erect or prostrate, rooting at the nodes of
prostrate branches”

Lundell 14926 (LL): “prostrate shrub”

Runyon 2315 (TEX): “erect, prostrate shrub”

Traverse 1040 (MO, TEX): “shrub-vine, 20 cm, crawling on ground,
ultimate twigs upright”

Other collections by Lundell (LL) have described the Texas plants
simply as “shrubs” varying in height from | to 6 feet).

In contrast, Florida plants consistently are described as shrubs
to small trees 1-3 meters high. Felger et al. (2001) described M.
phyllanthoides in northern Sonora as “Mound-shaped hardwood shrubs
or sometimes small trees 4~-6(—8) m,” and other collections from

66 Phytologia (April 2009) 91(1)

Mexico are characterized as trees 2-7 meters high, shrubs 2-6 feet
high, and shrubs 12 feet high. I have examined 120 collections (MO,
TEX, LL) of typical M. phyllanthoides from Florida and Mexico—none
was described as prostrate or decumbent.

Lundell (1969) and Correll and Johnston (1970) treated the
Texas/Tamaulipas plants as Maytenus texana Benth., citing M.
phyllanthoides var. ovalifolia Loes. as a synonym. Richardson (1995),
Turner et al. (2003), and the PLANTS Database (USDA, NRCS 2008)
have identified them as M. phyllanthoides. Leaf morphology and habit
of these plants, however, contrast with typical M. phyllanthoides and it
is useful to recognize them as a taxon distinct from the typical
expression. Still, the differences are relatively slight compared to those
between other species of Maytenus, and even though the
Texas/Tamaulipas population system appears to be geographically
separated from typical populations, there are seemingly intermediate
plants in San Luis Potosi that are erect shrubs but that have obtuse leaf
bases.

Mexico: San Luis Potosi. 1 km N of Huizache Jct, alkaline desert flat, 7
Nov 1960, Johnston 6034 (LL, TEX); ca 2 km airline SE of Huizache
Jct, ca 5 km W of El Huizache, matorral, 1400 m, 19 May 1973,
Johnston et al. 11113 (LL).

Treatment of the Texas/Tamaulipas plants at varietal rank is
appropriate, although a case might be made for recognizing them at
specific rank.

Maytenus phyllanthoides Benth., Bot. Voy. Sulphur 54. 1844.
Tricerma phyllanthoides (Benth.) Lundell, Wrightia 4: 158.
1971. Type: Mexico. Baja California Sur: Bay of Magdalena,
1837, R.B. Hinds s.n. (holotype: K).
Flowering Feb—-Aug or probably all year in some areas.
Dunes, inland margins of mangrove, along coastal bays and inlets,
near-coastal arroyos and salt scrub, alkaline desert flats, gypseous soil
along stream beds, matorral (Larrea-Flourensia, Agave-Larrea-
Dasylirion-Opuntia), cedar forests, mesquite woods; (2 m, dunes) 720—
2200 meters elevation. U.S.A. (Florida); Mexico (Baja California Sur,
Chiapas, Coahuila, Hidalgo, Jalisco, Nuevo Leon, Puebla, Querétaro,

Phytologia (April 2009) 91(1) 67

Quintana Roo, San Luis Potosi, Sinaloa, Sonora, Veracruz, Yucatan);
Cuba; Bahamas. I have examined specimens from all of the Mexican
states except Veracruz and Jalisco.

Maytenus phyllanthoides var. ovalifolia Loes., Repert. Spec. Nov.
Regni Veg. 8: 291. 1910. Type. Mexico. Tamaulipas. Rincon
del Toro on the “Laguna Madre,” Jun [1905], R. Endlich 552
(holotype: B). Endlich’s collection was made about 45 miles
south of Brownsville.

Maytenus texana Lundell, Phytologia 1: 306. 1939. Tricerma texana
(Lundell) Lundell, Wrightia 4:158. 1971. Type: U.S.A. Texas.
Cameron Co.: mesquite woods between Los Fresnos and Port
Isabel, 23 Apr 1933, E.U. Clover 986 (holotype: MICH).
Flowering Mar—Jun, fruiting Jun—Aug(—Dec). Shrublands and

thickets, commonly with Acacia and Forestiera, mud flats, salt flats,

low ridges, clay mounds, clay dunes, loamy sand, sandy clay, saline
clay; 2-10 meters elevation. U.S.A. (southern Texas); Mexico

(northeastern Tamaulipas). [Illustrations are published in Lundell

(1969, line drawing), Richardson (1995, color photo), and Everitt et al.

(2002, color photo).

I have seen only a single collection of var. ovalifolia from
Mexico: Tamaulipas. Coastal flats S of Matamoros, 9 Feb 1939,
LeSueur 529 (TEX).

ACKNOWLEDGEMENTS

I am grateful to the staffs at MO and TEX for their help and
hospitality and to Billie Turner for his review comments.

LITERATURE CITED

Correll, D.S. and M.C. Johnston. 1970. Manual of the Vascular Plants
of Texas. Texas Research Foundation, Renner, Texas.

Everitt, JH., D.L. Drawe, and R.I. Lonard. 2002. Trees, Shrubs, &
Cacti of South Texas (rev. ed.). Texas Tech Univ. Press, Lubbock.

68 Phytologia (April 2009) 91(1)

Felger, R.S., M.B. Johnson, and M.F. Wilson. 2001. The trees of
Sonora, Mexico. Oxford Univ. Press, New York.

Loesener, T. 1910. Mexikanische und zentralamerikanische
Novitaten. I. Repert. Spec. Nov. Regni Veg. 8: 291-299.

Lundell, C.L. 1939. Six new trees and shrubs from tropical North
America. Phytologia 1: 305-309.

Lundell, C.L. 1969. Celastraceae. Pp. 339-355 in Flora of Texas,
Vol. 2. Texas Research Foundation.

Richardson, A. 1995. Plants of the Rio Grande Delta. Univ. of Texas
Press, Austin.

Turner, B.L., H. Nichols, G. Denny, and O. Doron. 2003. Atlas of the
Vascular Plants of Texas. Vol. 1—Dicots. Sida, Bot. Miscellany,
Vol. 24.

USDA, NRCS. 2008. The PLANTS Database. National Plant Data
Center, Baton Rouge, Louisiana. <http://plants.usda.gov>.
Accessed August 2008.

Wunderlin, R.P. and B.F. Hansen. 2008. Atlas of Florida Vascular
Plants [S.M. Landry and K.N. Campbell (application
development), Florida Center for Community Design and
Research.] Institute for Systematic Botany, Univ. of South Florida,
Tampa. <http://www.plantatlas.usf.edu/>. Accessed August 2008.

Phytologia (April 2009) 91(1) 69

TWO ADDITIONS TO THE VASCULAR FLORA OF TEXAS

Jason R. Singhurst
Wildlife Diversity Program
Texas Parks and Wildlife Department,
Austin, Texas 78704 U.S.A.
jason.singhurst@tpwd.state.tx

David J. Rosen
S. M. Tracy Herbarium
Department of Rangeland Ecology & Management
Texas A&M University
College Station, Texas 77843-2126, U.S.A.

Walter C. Holmes
Department of Biology
Baylor University
Waco, Texas 76798-7388 U.S.A.
Walter_holmes@baylor.edu

ABSTRACT

Euthamia caroliniana is reported as new to Texas, while
Rhynchospora chapmanii is reported as new to Texas and the West
Gulf Coastal Plain. Phytologia 91(1):69-72 (April, 2009).
KEY WORDS: Asteraceae, Cyperaceae, Euthamia, Rhynchospora,
Louisiana, Texas, West Gulf Coastal Plain.
The following species are reported as new to Texas.
Euthamia caroliniana (L.) Greene ex Porter & Britton (Asteraceae).

Euthamia caroliniana (Haines 2006) is distributed from Nova
Scotia and Maine, south to Florida, and west to Michigan, Illinois, and

Louisiana. Until now, it has not been reported in Texas (Correll &
Johnston 1970, Turner et al. 2003, Haines 2006). The species was

70 Phytologia (April 2009) 91(1)

collected at Candy Abshier Wildlife Management Area adjacent to
Smith Point. This location is approximately 180 km west of the nearest
known occurrence of £. caroliniana in Jefferson Davis Parish,
Louisiana, where it is treated under the synonym Euthamia tenuifolia
(Pursh.) Nuttall (Thomas and Allen 1996).

Euthamia_ caroliniana occurred infrequently in a wet sandy
coastal prairie and adjoining salt pan (slicks) in small patches that
typically consisted of 5--10 plants. Several larger patches with 50--
100 plants were also present. The site was dominated by Bigelowia
nuttallii, Borrichia frutescens, Boltonia_ diffusa, Dichanthelium
acuminatum, Eupatorium glaucescens, Fimbristylis castanea, Fuirena
breviseta, Hypericum drummondii, Iva angustifolia, Liatris acidota,
Lythrum alatum, Morella cerifera, Rhynchospora plumosa, Scleria
georgiana, Schizachyrium tenerum, Solidago tortifolia, and Xyris
stricta.

Voucher specimen: TEXAS. Chambers Co.: Candy Abshier Wildlife
Management Area, Smith Point at the southwestern tip of FM 562 at
Galveston Bay, 4 Nov 2007, Singhurst 15467 (BAYLU).

Euthamia is a small genus of five species, closely allied to, but
distinct from Solidago (Haines 2006). Other species of the genus
known to occur in the state include E. gymnospermoides Greene and E.
leptocephala (Torrey & A. Gray) Greene (Turner et al. 2003, Haines
2006). A third species, E. graminifolia (L.) Nuttall is cited as occurring
in Texas by Turner et al. (2006), but is excluded from the state by
Haines (2006). A key to species and further information is available in
Haines (2006).

Rhynchospora chapmanii M.A. Curtis (Cyperaceae)

In Godfrey and Wooten (1979) and Kral (2000) Rhynchospora
chapmanii is considered to be endemic to the United States where it
occurs from North Carolina, south to Florida, and west to extreme
eastern Louisiana. There are, however, unpublished reports in the
TROPICOS Database of the species occurring in Belize and Nicaragua
(MOBOT 2008). Until the present paper, R. chapmanii had only been

Phytologia (April 2009) 91(1) 71

documented in the Southern Atlantic and Eastern Gulf Coastal Plains.
The record cited below constitutes the first known report of the species
not only in Texas, but in the West Gulf Coastal Plain as defined by
Bailey et al. 1994. This distribution pattern is common to a number of
other Eastern Coastal Plain species, such as Agrimonia_incisa,
Platanthera chapmanii, and Xyris smalliana, all present as disjuncts in
southeast Texas, but with the major part of their distributions being
from southeast Louisiana and eastward.

Rhynchospora chapmanii was collected in a shallow wetland
in a sandy coastal prairie in Candy Abshier Wildlife Management Area
adjacent to Smith Point. The site was dominated by Anthaenantia rufa,
Panicum rigidulum, Rhynchospora spp., Fuirena sp., and Eleocharis
sp. This location is about 450 km west of the nearest known
occurrence of R. chapmanii in St. Tammany Parish, Louisiana (Thomas
and Allen 1993).

TEXAS. Chambers Co.: Smith Point, Candy Abshier Wildlife
Management Area, Take IH 10 E to SH 61 at Hankamer, S on SH 61
for four miles to FM 562, turn onto FM 562 and continue S then W for
22 miles on FM 562 to Smith Point, 01 Nov 2007, Rosen 4660 (BRIT,
TEX, VDB.

ACKNOWLEDGEMENTS

We are grateful to Billie (B.L.) Turner and Tom Wendt for
their assistance at the University of Texas Herbarium (TEX). We would
also like to thank Robert Kral for his confirmation of Rhynchospora
chapmanii.

LITERATURE CITED

Bailey, R.G., P.E. Avers, T. King, and W.H. Mc Nab. 1994. Ecoregions
and subregions of the United States (map). Washington, D.C., U.S.
Department of Agriculture-Forest Service, scale 1:7,500,000.

Correll, D. S. and M. C. Johnston. 1970. Manual of the vascular plants of
Texas. Texas Research Foundation, Renner.

72 Phytologia (April 2009) 91(1)

Haines, A. 2006. Euthamia. In: Flora of North America Editorial
Committee, eds. Flora of North America 20. Oxford Univ. Press,
New York, pp. 97—100.

Godfrey, R.K. and J.W. Wooten. 1979. Aquatic and wetland plants of
the southeastern United States. Monocotyledons. Univ. of Georgia
Press, Athens.

Kral, R. 2000. Rhynchospora. In: Flora of North America Editorial
Committee, eds. 1 Flora of North America 23. Oxford Univ. Press,
New York, pp. 200-239.

Thomas, R, D. and C. M. Allen. 1993. Atlas of the vascular flora of
Louisiana. Vol. 1. Ferns & Fem Allies, Conifers, &
Monocotyledons, Louisiana Department of Wildlife & Fisheries,
Baton Rouge.

Thomas, R, D. and C. M. Allen. 1996. Atlas of the vascular flora of
Louisiana. Vol. II: Dicotyledons. Acanthaceae - Euphorbiaceae.
Louisiana Department of Wildlife & Fisheries, Baton Rouge.

MOBOT 2008. The TROPICOS Database
(hitp://mobot.mobot.org/W3T/Search/vast.html, 14 Feb 2008)
Missouri Botanical Garden, St. Louis, Missouri.

Turner, B. L., H. Nichols, G. Denny, and O. Doron. 2003. Atlas of the
vascular plants of Texas. Vols. 1 and 2. Sida Bot. Misc. 24.
Botanical Research Institute of Texas, Fort Worth.

Phytologia (April 2009) 91(1) 73

ROMULEA ROSEA (IRIDACEAE): ADVENTIVE IN TEXAS

Jason R. Singhurst
Wildlife Diversity Program
Texas Parks and Wildlife Department,
Austin, Texas 78704 U.S.A.
jason.singhurst@tpwd.state.tx

Kay M. Fleming
809 E. Clinton Ave.
Athens, Texas 75751 U.S.A.

Ruth Loper
13456 CR 2235
Whitehouse, Texas 75791 U.S.A.

Virginia Privett
14839 CR3520
Brownsboro, Texas 75756 U.S.A.

and
Walter C. Holmes
Department of Biology
Baylor University

Waco, Texas 76798-7388 U.S.A.
walter_holmes@baylor.edu

ABSTRACT

Romulea rosea is reported as adventive in Texas.
Phytologia 91(1):73-75 (April, 2009).

KEY WORDS: Iridaceae, Romulea, Texas, invasive plant.

Romulea is a genus of about 90 species that is distributed in
Africa, southern Europe, and the Middle East (Goldblatt 2002). One

74 Phytologia (April 2009) 91(1)

species, R. rosea, the sand crocus, a native of South Africa, is
naturalized in Europe, the British Isles, Australia, New Zealand and in
several coastal counties of California (The Nature Conservancy 2005).
Based upon the specimens cited below, this species may now be
reported as adventive in Texas.

Romulea rosea (L.) Eckl. (Iridaceae).

Voucher specimens: TEXAS. Henderson Co.: West side of County
Road 3520, ca. 200 yards south of the junction of County Road 3520
and FM 2339, 24 Mar 2005, Fleming 1211 (BAYLU); West side of
County Road 3520, ca. 200 yards south of the junction of County Road
3520 and FM 2339, 25 Mar 2005, Fleming 1212 (BAYLU).

In 2005, the population consisted of approximately twenty
individuals scattered over about one-half hectare under closed,
undisturbed forest canopy dominated by Pinus taeda, Liquidambar
styraciflua, Quercus spp., and Carya sp. In March 2008, the population
was estimated to be “at least 100 plants over a larger area” (Fleming,
pers. obs.).

Five varieties of Romulea rosea are recognized by de Vos
(1972). The specimens reported here correspond to variety R. australis
(Ewart) M. P. de Vos. Goldblatt (2002) mentions that this variety has
become a common weed of lawns, pathways, and roadsides in
Australia, where it is a pest. He further mentions that, to date, this
situation does not seem to be the case for the parts of California where
the species occurs. While at present there is no evidence of the species
becoming a pest in Texas, its invasive nature in Australia justifies that
its presence in the state be closely monitored.

Romulea rosea exhibits a pattern of spread that is similar to
several other species reported as adventive in Texas. These species
were initially reported as adventive to California (or the west coast),
then later discovered in eastern Texas. However, the source of the
plants adventive in Texas is unknown. Plants with this pattern of
distribution include Bellardia trixago (L.) All. (Scrophulariaceae)
(Lipscomb & Ajilvsgi 1982, Do et al. 1996), Centaurium muhlenbergii
(Griseb.) Piper (Gentianaceae) (Holmes & Wivagg 1996), and
Parentucellia viscosa (L.) Caruel (Scrophulariaceae) where it appears

Phytologia (April 2009) 91(1) ff)

to have been a “late” entry into the Manual of the Vascular Plants of
Texas (Correll & Johnston 1970). Inclusion in the manual was based
upon a 1969 collection (Correll 37239, TEX) of the species in Jasper
Co. Tracing the application of the name in the state was complicated
by the name not being included in the index of the manual.

ACKNOWLEDGEMENTS

We are grateful too Dr. Lynn Sherrod at University of Texas
at Tyler for his assistance with determining the species of Romulea.

LITERATURE CITED

De Vos, M. P. 1972. The genus Romulea in South Africa. J. S. African
Bot., suppl. 9.

Correll, D. S. and M. C. Johnston. 1970. Manual of the Vascular Plants of
Texas. Texas Research Foundation, Renner.

Do, L. H., W. C. Holmes, and J. R. Singhurst. 1996. New County
Records for Bellardia trixago (Scrophulariaceae) in Texas. Sida
17: 291-294.

Goldblatt, P. 2002. Romulea. In: Flora of North America Editorial
Committee, eds., Flora of North America North of Mexico 26.
Magnoliophyta: Liliidae: Liliales and Orchidales. Oxford Univ.
Press, New York and Oxford. p. 407 [illustration p. 406].

Holmes, W. C. and D. E. Wivagg. 1996. Identification and
Distribution of Centaurium muhlenbergii and C. pulchellum
(Gentianaceae) in Louisiana, Mississippi, and Texas. Phytologia
80: 23-29

Lipscomb, B. and G. Ajilvsgi. 1982. Bellardia trixago (L.) All.
(Scrophulariaceae) adventive in Texas. Sida 9:370-374.

The Nature Conservancy of Texas. 2005. Global Invasive Species
Team. http://tncweeds.ucdavis.edu/alert/alrtromu.html, 20 March
2008.

76 Phytologia (April 2009) 91(1)

TAXONOMY OF IVA ANGUSTIFOLIA AND I. ASPERIFOLIA
(ASTERACEAE)

B. L. Turner
Plant Resources Center
The University of Texas at Austin
Austin, Texas 78712
billie@uts.cc.utexas.edu

ABSTRACT

Iva angustifolia and I. asperifolia are treated as belonging to a
single species, /. asperifolia. The species is treated as having three
varieties: var. angustifolia, widespread in the south-central U.S.A.; var.
latior, largely confined to the beaches of southern Texas; and var.
asperifolia, confined to the coastlines of central Mexico, with an
introduced outlier in Wakulla Co., Florida. Keys to the taxa are
provided, along with maps showing their distribution.

Phytologia 91(1):76-83 (April, 2009).

KEY WORDS: Asteraceae, [va angustifolia, I. asperifolia, I. texensis,
Texas, Mexico, Florida

Strother (2006), in his treatment of /va for the Flora of North
America, provided a taxonomic account of /. angustifolia Nutt. ex DC.
In this he did not provide for infraspecific categories, nor did he discuss
its relationship to its closest congener, /. asperifolia, a taxon from dune
sands along the Gulf Coast of Mexico. He did place in synonymy
under his broad interpretation of /. angustifolia the names I. a. var.
latior Shinners and J. texensis R.C. Jackson, both typified by material
from sandy or clay saline dunes of southernmost coastal Texas.

Jackson (1960) proposed the name /va texensis (typified by
Jackson 2505 from saline soils ca. 8 mi S of Falfurrias, Brooks Co.,
Texas). Oddly, other than the type, he listed numerous additional
collections, these introduced with the statement that “A number of
specimens from the coastal regions of Texas are tentatively assigned to

Phytologia (April 2009) 91(1) 7

I. texensis. These plants have a woody stem, but in involucral length
and plant height are not always in agreement with the type.”

Shinners (1964) inexplicably described again Jackson’s /va
texensis with his proposal of /. angustifolia var. latior, the latter also
typified by specimens from Brooks Co., Texas. Indeed, Shinners did
not mention /. fexensis in his account of the proposed variety, although
he did cite Jackson’s revision of /va in which the name was first
proposed.

Strother’s account of J/va angustifolia for the U.S.A. is
confounded by the earlier name, /. asperifolia Lessing, this proposed in
1830. Strother did comment upon the latter, noting in the introduction
to his treatment, that “Records of /va asperifolia Lessing from Florida
are evidently based on specimens that are treated as members of /.
angustifolia.” A similar sentiment was expressed by Wunderlin (1998)
who thought the name /. asperifolia, was “misapplied” to plants from
Wakulla Co. Florida, that he took to be /. angustifolia. This, in spite of
the fact that Jackson (1960) stated, “The specimens of /. asperifolia
from Florida may represent an introduction [of 4. asperifolia] from
Mexico.” Plants grown from seeds by Jackson in his greenhouse (the
seeds provided by Dr. R. K. Godfrey from Wakulla Co.) reportedly
“gave plants with procumbent terms (sic).” Jackson further noted that
the Mexican plants, which he observed along the beaches of Veracruz,
Mexico, were similarly decumbent perennials that root at the nodes.
One must assume that Jackson knew what he was talking about, hence
the comments of Clewell (1985), no doubt bowing to the judgment of
Jackson to the effect that the Wakulla populations, which he took to be
I. asperifolia, are “decumbent perennials rooting at the nodes;” Clewell
further noted that the plants occur in tidal marshland and were
“Probably introduced from Mexico.” I have also examined collections
from the Florida populations concerned and they appear to be closer in
habit to /. asperifolia than to /. angustifolia, as noted by Jackson.

Miao, Turner and Mabry (1995) examined chloroplast DNA
variation in all species of /va, except for the mostly Cuban, /.
cheiranthifolia. Their study included all four species of sect.
Linearibractea R.C. Jackson, which included /. angustifolia, I.
asperifolia, I. texensis, and I. microcephala. Indeed, in their sequence
divergence study the four species of sect. Linearibractea formed a tight

78 Phytologia (April 2009) 91(1)

cluster, the most distinct being /. microcephala, which was found to be
the most divergent member of the tetrad. The remaining three taxa
were found to have few differences among them. In particular, the two
herbaceous taxa, /. angustifolia and I. asperifolia, were found to differ
by only one restriction site mutation. Unfortunately, DNA data for J.
asperifolia was obtained from the Wakulla Co. population, which
Jackson accepted as an introduction from the Mexican beaches. The
taxonomic status of the latter population is controversial, as noted in the
above. Considering the Pleistocene history of the southeastern U.S.A.,
it is possible that the Wakulla population is but an isolated relic of a
once more widespread, highly variable, var. angustifolia, perhaps
deserving of its own formal varietal name. Additional study of the /.
asperifolia complex is clearly needed, especially from Tamaulipas
where the two taxa presumably intergrade.

With the above as an introduction, I hasten to add that I also
(Turner et al. 2003) recognized Texas populations of the J. asperifolia
complex as J. angustifolia, largely following the work of Jackson.
Unlike Strother, I did recognize the more robust, seemingly perennial,
var. latior of Shinners, with the assumption that it intergraded
northwards along the shores of Texas into the typical var. angustifolia,
as also noted by Jackson. I also believe that the var. /atior intergrades
southwards along the Gulf beaches of Mexico into var. asperifolia. This
suggested by a single intermediate, cited below. I provide herein a
synopsis of the /. asperifolia complex as currently understood, along
with a nomenclature that appears to fit the biology.

IVA ASPERIFOLIA Lessing, Linnaea 5: 151. 1830.

TYPE: MEXICO. VERACRUZ: Mpio. Veracruz, “In pascuis pr.
Vera-Cruz.” Jul. Scheide 332 (holotype B; fragment and drawing, GH).

Jackson (1960) provided a detailed description of the taxon,
positioning it in his sect. Linearbractea.

Phytologia (April 2009) 91(1) 79

Key to infraspecific taxa:

1. Plants annuals mostly 0.75 m high or less; south-central U.S.A.

Ole as Pexts Ark: s Lai )ic. oi) aad id ne caWedenee tenses var. angustifolia
1. Plants perennial herbs to 1.5 m high; Gulf Coastal dunes,
southernmost Texas, northern Mexico and panhandle Florida...... (2)

2. Stems decumbent, rooting at the nodes; leaves mostly oblong-
lanceolate; involucres without markedly spreading, broad-based
hairs; coastal Tamaulipas and Veracruz, Mexico...... var. asperifolia

2. Stems stiffly erect, only rarely rooting at the nodes; leaves mostly
lanceolate; involucres with markedly broad-based spreading hairs,
rarely not; northern coastal Tamaulipas, Mexico, and southern Texas
WRB SCG Saatste devin cinder abs cctlin uote Ue tas cadebcneaeaeeandethos var. latior

IVA ASPERIFOLIA var. ANGUSTIFOLIA (Nutt. ex DC.) B.L
Turner, stat. & comb. nov. Fig. |

Based upon /va angustifolia Nutt. ex DC., Prodr. 5: 529. 1836.
TYPE: U.S.A. ARKANSAS: without locality, Nuttall s.n. (holotype:
G-DC; isotype NY)

Jackson (1960) provided an adequate account of this taxon,
noting in his key the principal differences that distinguish it from var.
latior, the latter being larger, mostly perennial, plants having somewhat
larger involucres, the latter well endowed with spreading hairs. In my
opinion, var. angustifolia grades into var. /atior in regions of near
contact, as noted below, hence their treatment as but populational
variants (or variety) of a widespread /va asperifolia.

Varity angustifolia is highly variable and, other than habit, is
best recognized by a suite of characters, most having to do with the
involucre, as noted below and by Jackson (1960).

IVA ASPERIFOLIA Lessing var. ASPERIFOLIA Fig. 1, 2

As noted in Figures 1 and 2 (based upon specimens at MEXU,
TEX), this taxon is restricted to the Gulf Coastal area of northern
Tamaulipas and Veracruz, Mexico, with an isolated population in

80 Phytologia (April 2009) 91(1)

Wakulla Co., Florida. In Tamaulipas, Mexico, it seemingly grades into
the var. /atior, to judge from the following collection: Mpio. Altamira,
Dunas 856 (MEXU, TEX).

The taxonomic status of the Florida populations of var.
asperifolia is in doubt. According to label data on Godfrey 70060
(TEX), the Wakulla population occurs “On a large flat area into which
spoils from dredging of the St. Marks River had been placed; very
abundant; St. Marks.” The DNA voucher of Miao et al. (1995) was
obtained “In limestone piles of spoil, St. Marks, just west of end of
county Road 363 and north of St. Marks River.” Both of the
aforementioned collections are seemingly perennial. The Godfrey
collection has a capitulescence much resembling var. angustifolia; the
Miao voucher (Garland 751, TEX) has an atypical capitulescence.
Based on the DNA data from the latter voucher and the comments of
Jackson (1960), it would appear that the Wakulla population is closest
to var. asperifolia. Alternatively, it is remotely possible that the
Wakulla populations represent a localized yet undescribed variety of J.
asperifolia, as noted above.

IVA ASPERIFOLIA var. LATIOR (Shinners) B.L. Turner, comb.
nov. Fig.1

Based upon /va angustifolia var. latior Shinners, Sida 1: 378. 1964.
TYPE: U.S.A. TEXAS: Brooks Co., “south of Falfurrias.” 15 Sep
1942, Lundell & Lundell 11947 (holotype SMU; isotypes LL!)

Iva texensis R.C. Jackson, Univ. Kansas Sci. Bull. 41: 807. 1960.
TYPE: U.S.A. TEXAS: Brooks Co., 8.1 mi S of Falfurrias along U.S.
highway 281, 24 Aug 1957, Jackson 2505 (holotype KANU; isotype
SMU)

Jackson’s Iva texensis was published prior to Shinner’s var.
latior; unfortunately nomenclatural priority is predicated upon rank;
were the present taxon recognized as a species, its correct name would
be 1. texensis!

Variety /atior is a perennial herb to 1.5 m high, largely
confined to the Gulf Coastal region of Texas, mostly occurring in sandy

Phytologia (April 2009) 91(1) 81

or clay dunes along the beach front; numerous collections are in the
herbarium at TEX (35 from along the coastal areas of Cameron,
Kenedy and Nueces counties).

The earliest collections of var. /atior were made by Robert
Runyon in Cameron County between the years 1924-1945 (TEX, LL).
He noted that the taxon was sufficiently well known as to have received
the local common name “Pelocote.” And that the taxon occurs “only
along sea shore as colonies on sand dunes;” and describes its habit as an
“erect branched herb,” or “fruticose herb.” Nevertheless, it also occurs
sporadically inland into the Tamaulipan Biotic Province of southern
Texas, as indicated in Fig. 1. Occasional intergrades between var.
latior and var. angustifolia in this area are discerned (e.g., Carr 22574,
Refugio Co., TEX). The more strictly coastal populations of var. /atior
pass into var. angustifolia near Galveston, Texas, the latter becoming
strictly taprooted annual herbs mostly 0.5 m high or less, having
smaller involucres with mostly shorter appressed hairs.

As suggested by its dune-site proclivities in Kenedy and
Cameron counties, it is almost certain that southwards var. /atior grades
into var. asperifolia, as suggested by the intermediate specimen cited
above. Even among the Texas coastal populations, some degree of past
introgression is likely, to judge from the variation in leaf shape and
pubescence noted among the Cameron county populations.

ACKNOWLEDGEMENTS

I am grateful to my colleagues, Guy Nesom and John Strother
for reviewing the paper and providing helpful comments. Thanks also
to MEXU for the loan of specimens, these critical in the construction of
distribution maps for /va asperifolia var. asperifolia.

LITERATURE CITED

Clewell, A.F. 1985. Guide to the Vascular Plants of the Florida
Panhandle. Florida State Univ. Press, Tallahassee

Jackson, R.C. 1960. A revision of the genus /va L. Univ. Kansas Sci.
Bull. 41: 793-875.

82 Phytologia (April 2009) 91(1)

Miao, B., B.L. Turner and T.J. Mabry. 1995. Molecular phylogeny of
Iva (Asteraceae, Heliantheae) based on chloroplast DNA restriction
site variation. Pl. Syst. Evol. 195: 1-12.

Strother, J.L. 2006. Iva, in Fl. N. Amer. (N. of Mexico.) 21: 25-28.

Turer, B.L., H. Nichols, G. Denny and O. Doron. 2003. Atlas of the
Vascular Plants of Texas 1: 1-648.

Wunderlin, R.P. 1998. Guide to the Vascular Plants of Florida. Univ.
Press, Florida

asperifolia
® var. angustifolia
© var. latior

* var. asperifolia

Fig.1. Distribution by county (and parish) of /va asperifolia in the
U.S:A:

Phytologia (April 2009) 91(1) 83

asperifolia

o var. asperifolia
© intermediate

e var. latior

Fig. 2. Distribution of /va asperifolia in Mexico.

84 Phytologia (April 2009) 91(1)

A NEW SPECIES OF TRIXTIS (ASTERACEAE: MUTISIEAE)
FROM JALISCO, MEXICO

B. L. Turner
Plant Resources Center
The University of Texas at Austin
Austin, Texas 78712
billie@uts.cc.utexas.edu

Phytologia 91(1):84-87, (April, 2009)

Preparation of a treatment for the Mutisieae of Mexico has
occasioned description of the following novelty:
TRIXIS JALISCANA B.L. Turner, sp. nov. Fig. |

Trixi haenkei Schultz-Bip. similes sed foliis juvenilibus subtus dense
villosis (vs moderate vel sparsim villosis), setis pappi fulvis (vs albis),
et capitulescentia congestae (vs expansae).

TYPE: MEXICO. JALISCO: Mpio. Mascota, 1 km E of Mascota,
“dry, shrubby slopes,” 1230 m, 1 Mar 1970, W.R. Anderson & C.
Anderson 5905 (Holotype: LL).

Shrub 1-3 m high, “branching from the base and from lax branches.”
Stems wingless, densely soft-pubescent. Leaves lanceolate, 5-15 cm
long, 1-4 cm wide; petioles 0-10 mm long. Capitulescence a terminal,
tightly congested, corymbose panicle, the ultimate peduncles 0-1 mm
long. Accessory bracts 2-4, lanceolate, mostly half as long or less than
the involucre. Involucral bracts 8, ca 12 mm long, their apices
abruptly acute. Receptacle ca 2 mm wide, pubescent with hairs up to 2
mm long. Florets 10-20 per head; corollas yellow, the upper lip 3-4
mm long, the tube 8-10 mm long. Achenes pubescent throughout, 6-9
mm long; pappus of numerous tawny bristles 8-10 mm long.

ADDITIONAL SPECIMENS EXAMINED: MEXICO. JALISCO:
Mpio. Chapala, “Barranca proxima a Ajijic,” 1650 m, 12 Nov 1978,
Luna 9370 (TEX). Mpio. Jocotepec, “Ladera sur al norte de la
barranca del Huazoyo.” 7 Mar 1993 Machuca N. 6923 (TEX). Mpio.
Mixtlan, between Ameca and Atenguillo, 5100-5500 ft., 4 Mar 1987,

Phytologia (April 2009) 91(1) 85

Daniel & Bartholomew 4830 (TEX). Mpio. San Sabastian, N of
Mascota on road to San Sebastian, 1450-1730 m, 1-3 Mar 1970,
Anderson & Anderson 5951 (TEX).

In her seminal treatment of Mexican 7rixis, Anderson
(1972) clearly called to the fore the present novelty. She noted that the
type of T. haenkei was probably collected by Seemann “in the
mountains along the Sinaloa-Durango border, east of Mazatlan.” At the
time of her study Anderson knew of only two collections from the area
of the type locality concerned, the type and Anderson & Anderson
6177. She further noted that the latter collection differed from “the
type as well as from the Jalisco collections” in having a white pappus,
and inflorescence branches which bear small corymbs that are more
than twice as long as those in specimens from Jalisco. I have examined
the Anderson & Anderson collection and one additional collection from
the area of the type locality: Rito Vega 3624 (TEX), this from Sinaloa
between km 240 and 256 along the Ojo de Agua to la Guayamera
highway. Both of these collections are very similar, and the characters
called to the fore by Anderson hold for both. I have not examined the
holotype itself, which is reportedly at Kew, nor did Anderson. She did,
however, examine a photo of the holotype, as have I. From the photo |
found it difficult to judge the characters called to the fore by Anderson.
I did, however, borrow what I take to be an isotype from GH and found
this to be closely akin to the other two collections from the Sinaloa-
Durango border. In short, all material from along the Sinaloa-Durango
border is clearly the same and is not to be confused with the presently
described 7. jaliscana, T. haenkei occurring in tropical deciduous
forests (600-800 m) “just below the oak zone,” and T. jaliscana
occurring in pine-oak forests at much higher elevations (1200-2000 m).
Further, among the Jalisco collections I detected no intermediates
between the two regional populations concerned, which leads me to
believe that the taxa are sufficiently distinct, both morphologically and
ecologically, for specific recognition (as opposed to varietal).

1. Young leaves moderately to sparsely densely villous beneath; pappus
bristles white; capitulescence open; deciduous forests below the oak
LEE EEG RE NE Rs a T. haenkei

1. Young leaves densely villous beneath; pappus bristles tawny;
capitulescence tightly congested; pine-oak forests..........T. jaliscana

86

TAT

OOO E

Fig. 1. Holotype of Trixis jaliscana.

Phytologia (April 2009) 91(1)

LUNDELL |
| HERBARIUM |
Ei Sins

Thee Vienionrsity: oh Teaane
AUSTIN, TEMAS

pom erneraattmrnrtenericg
:
;

Cites 4h

The Univonvety tl Tena tincnaetiaen ORNS
Trine jabincams WL. Turner
Gut, BL. Tiemer Bet

PLANTS OF JALISCO, MEKICO
atl
esamentiontarnare iki ken CT
AAR NBD, TRG ame KERR ROSIE Ramet BNE HA ie Um Ie:

Triste beenket Uchaeliip, in Gemma

Ory, ahrubhy wlopes atone 1 kw & or
Mansotay eler. 129 9,

Amadt ahah to 2 me tall, berenond ng

trom the bane and fem tke Ya teraeches ¢
athitatant,

© ANCE aE & Renee MeCN

we, 9G 4 neces

Phytologia (April 2009) 91 (1) 87

ACKNOWLEDGEMENTS

I am indebted to Guy Nesom for the Latin diagnosis, and for
improving the manuscript itself. I am also grateful to GH for loan of
type material.

LITERATURE CITED
Anderson, C.E. 1972. A monograph of the Mexican and Central
American species of Trixis (Compositae). Mem. New York Bot.

Gard. 22: 1-68.

McVaugh, R. 1984. Trixis, in Fl. Novo-Galiciana 12: 953-963.

TRIXIS
o haenkei
@ jaliscana

Fig. 2. Distribution of Trixis haenkei (circles) and T. jaliscana (dots).

88 Phytologia (April 2009) 91(1)

CARMINATIA PAPAGAYANA (ASTERACEAE:
EUPATORIEAE),
A NEW SPECIES FROM WESTERN GUERRERO, MEXICO

B. L. Turner
Plant Resources Center
The University of Texas at Austin
Austin, Texas 78712
billie@uts.cc.utexas.edu

Phytologia 91(1):88-91 (April, 2009)

Routine identification of Mexican Asteraceae has revealed the
following novelty:

CARMINATIA PAPAGAYANA B.L. Turner, sp. nov. Fig. |

Carminatia recondita McVaugh similis sed differt capitulescentia
stricta laxa corymboidei capitulis in pedunculis ultimis 1-4 cm longis
portatis (vs. capitulis congestis in pedunculis 1-3 mm longis).

Annual herbs 20-70 cm high. Stems (lower) ca 3 mm across,
pubescent with crinkly hairs. Leaves (lower) 4-5 cm long, 2-3 cm
wide; petioles 2-3 cm long, glabrous or nearly so; blades broadly
ovate to deltoid, glabrous above and below , the margins somewhat or
weakly dentate. Capitulescence a terminal array of stiffly erect
peduncles, the ultimate peduncles 1-4 cm long, pubescent like the
stems. Heads cylindric, containing ca 15 florets, ca 14 mm high, 4-5
mm across. Involucres ca 12 mm high, glabrous; outer bracts 4-8, 1-6
mm long. Receptacle ca 1 mm across, glabrous. Corollas white,
glabrous, cylindrical, 7-8 mm long, ca 0.8 mm wide. Achenes 4-5
ribbed, minutely pubescent with very short, broad-based hairs; pappus
of ca 15 white, plumose, bristles ca 7 mm long; chromosome number,
2n = 20.

TYPE: MEXICO. GUERRERO: Mpio. Tierro Colorado,
"Acapulco. Autopista del Sol Mexico-Acapulco, zona rocosa a unos
metros del puente sobre el Rio Papagayo. ..Selva baja caducifolia.

Phytologia (April 2009) 91(1) 89

Occasional 280 m," 17 08 02.9 N 99 33 24.2 W, 9 Oct 1995, Jose L.
Panero 6193 [with C. C. Clevinger] (Holotype: TEX).

As indicated in Fig. 1, the present novelty differs from all
previously described species in having its heads arranged in stiffly erect
peduncles 1-3 cm long. It also appears to be restricted to deciduous
forests along the lower slopes of the Sierra Madre of western Guerrero.
Yet other species of the genus in Guerrero occur at higher, more eastern
locales, as noted in Fig. 2, the latter based upon specimens at LL, TEX
and those mapped in Turner (1997). Strother and Panero (2001) report
a chromosome number of 2n = 20 for the type (identified as C.
recondita McVaugh), this consistent with previous reports for the
genus.

The taxon is named for the Papagayo River, from whence the
type and only known collection.

ACKNOWLEDGEMENTS

I am grateful to Guy Nesom for the Latin diagnosis and
helpful comments on the manuscript itself.

LITERATURE CITED

Strother, J.L. and J.L. Panero. 2001. Chromosome studies: Mexican
Compositae. Amer. J. Bot. 88: 499-502.

Turner, B.L. 1997. Carminatia, in Phytologia Memoirs 11, The Comps
of Mexico 1: 84-86.

90 Phytologia (April 2009) 91(1)

UNIVERSITY OF
EK AS

HERG ANION

ees
:

iin oi
BIBLE ANE! palin BAH Wane BENS Re me ML,
oa Va
j

SUS nnn scene ME

PLANTAS DE MEXICO

mnt

Carminatia revomsdhite MeVaugety

4 +n ek tnid Setiradcns.
Chr demew a venchewe 2 2M x has pra 4 Ard panewie witha 93 Bane
Yonaneen i his vee
Stather + Panere | i007} : ee aa

vi

tore:ne fe satowcstlins {aaron
28 W O949
hai 8. Parnes aes PRAT TIS
Weta C. Clewin

PRS ES GCS MR HS ONTO RAST C8 TRAN ERR AReOM ert

Fig. 1. Carminatia papagayana, holotype.

Phytologia (April 2009) 91(1)

CARMINATIA

A alvarezii
* papagayana
* recondita
© tenuiflora

Map 1

Fig. 2. Distribution of Carminatia spp. in Mexico.

9]

92 Phytologia (April 2009) 91(1)

DELWIENSIA, A NEW GENUS OF ASTERACEAE

W. A. Weber, F.L.S. & R. C. Wittmann
University of Colorado Museum of Natural History
UCB 265, Boulder, Colorado 80309
bill.weber@colorado.edu

KEY WORDS: Asteraceae, Artemisia pattersonii, Delwiensia
pattersonii. Phytologia 91(1):92-94 (April, 2009).

The genus Delwiensia is proposed to accommodate Artemisia
pattersonii A. Gray on cytological and morphological grounds.

Delwiensia W. A. Weber & R. C. Wittmann, gen. nov.,
Asteraceae. Type, Artemisia pattersonii A. Gray, Syn. Fl. N. Amer. ed.
2, 1(2):453.1886. The genus name honors Delbert Wiens, contemporary
American plant taxonomist, specialist in the Viscaceae, plant
reproduction concerning embryonic abortion, and pollination by small
mammals.

Herba aspectu speciei Artemisiae in subgenere Absinthio,
numero chromosomatico n = 7, habitu inflorescentiae determinato.

Herb with the appearance of a species of Artemisia in the
subgenus Absinthium, with the chromosome number n = 7, and with the
inflorescence determinate.

Delwiensia pattersonii (A. Gray) W. A. Weber & R. C.
Wittmann, comb. nov. Basionym: Artemisia pattersonii A. Gray.

Delwiensia is a monotypic genus endemic to the alpine tundra
of Colorado, Wyoming, and New Mexico. It is superficially similar to
Artemisia scopulorum but is amply distinct morphologically, its most
obvious characters being the smaller number of heads in determinate
rather than indeterminate arrays. Wiens and Richter (1966) point out
that the root systems of the two species differ, A. pattersonii
reproducing vegetatively from branched rhizomes and A. scopulorum
having an unbranched caudex. Furthermore, A. pattersonii is unique in
Artemisia in having a chromosome number of n = 7. The known base

Phytologia (April 2009) 91(1) 93

numbers in Artemisia are x = 8 and predominantly x = 9. The details of
the karyotype did not support the notion that the two species are related.
In Sphaeromeria (see discussion below) the chromosome number is x =
9. It is of course possible that De/wiensia pattersonii might be found in
the Asiatic flora and thus would be considered a Tertiary relic (Weber
2002), but cytological and morphological information need to be
obtained for the numerous Asiatic species of Artemisia-like genera and
species. Rydberg (1929) had the following pungent remarks about the
inflorescences (from Scylla or Charybdis).

This lumping, advocated by Hall and Clements, has
also. been practiced by them. They include
Sphaeromeria Nutt., Vesicarpa and Chamartemisia in
Tanacetum. The only characters that Hall and
Clements have left to separate Tanacetum and
Artemisia are “Inflorescence cymose, the cyme
occasionally reduced to a single head” in Tanacetum
and “Inflorescence racemose-paniculate” in
Artemisia. The inflorescence, strictly speaking, is
neither cymose nor racemose-paniculate in either, for
both have the flowers in heads. In my own treatise of
the group I have used the word corymbiform instead
of cymose, which I think is much better. Whether the
heads are arranged cymosely or racemosely is hard to
tell. If cymosely, the terminal and central head should
be best and first developed. In such a case Artemisia
pattersonii should be included in Tanacetum. The
heads of that species have exactly the same
arrangement as in Chamartemisia compacta or
Sphaeromeria simplex, that is, usually one or two
heads, the terminal one the larger. If the heads are
congregated into a spherical cluster as in Artemisia
glomerata and A. globularia and Sphaeromeria
capitata (according to Hall and Clements a
Tanacetum), it would be hard for anyone to tell
whether the heads are arranged cymosely or
racemosely. In Vesicarpa potentilloides (also a
Tanacetum) [Sphaeromeria potentilloides (A. Gray)
Heller] I cannot tell if the inflorescence is racemose

94 Phytologia (April 2009) 91(1)

or cymose and I have dabbled in taxonomy for 50
years.

Shultz (2006) distinguishes A. scopulorum (heads in spiciform
arrays, and corolla lobes hairy) from A. pattersonii (heads being borne
singly or 2-5, spreading to nodding, pedunculate, in paniculiform or
racemiform arrays, and corollas mostly glabrous). The inflorescence
can be better described as being determinate versus indeterminate.
Rydberg’s explanation is to this point.

ACKNOWLEDGEMENTS
We thank Patricia Eckel for refining our Latin description.
LITERATURE CITED

Rydberg, Per Axel. 1929. Scylla or Charybdis. Proc. International
Congress Plant Sciences 2:1539-1551.

Shultz, Leila M. 2006. Artemisia, in Flora of North America, Vol. 19.
Flora of North America Editorial Committee. Oxford Univ.
Press.

Weber, William A. 2003. The Middle Asiatic element in the Southern
Rocky Mountain flora of the western United States: A critical
biogeographical review. J. Biogeography 30:649-685.

Wiens, Delbert, & Judith A. Richter, 1966. Artemisia pattersonii: a 14-
chromosome species of Alpine Sage. Amer J. Bot. 55:981—
986.

Phytologia (April 2009) 91 (1) 95

ZAMIA FLORIDANA (ZAMIACEAE),
THE CORRECT NAME OF THE FLORIDA CYCAD

Daniel B. Ward
Department of Botany, University of Florida
Gainesville, Florida 32611, U.S.A.

ABSTRACT

The view is accepted that the Zamia native to the West Indies
consists of several species, one of which is native also to Florida. The
earliest available binomial for the Florida taxon is Zamia floridana A.
DeCandolle (1868). An earlier binomial, Zamia integrifolia Linnaeus
filius in Aiton (1789), by citation in synonymy of the prior Zamia
pumila Linnaeus (1763), was superfluous when published and is thus
illegitimate. Phytologia 91(1):95-104 (April, 2009).

KEY WORDS: Zamia floridana, Zamiaceae, nomenclature.

INTRODUCTION

The West Indian complex of cycads in the genus Zamia
(Zamiaceae) has been treated by Eckenwalder (1980) as composed of a
single species with populations that vary in leaflet width and vein
number but are not appropriately divided into more than a single
species, Z. pumila L. (1763). This interpretation has been accepted by
some authors (e.g. Wunderlin, 1998; Wunderlin & Hansen, 2000), and
Z. pumila is frequently used in Florida horticulture.

A subsequent review of the West Indian cycads by Stevenson
(1987a; 1987b; 1991), which incorporated leaflet shape and
denticulation and cone shape and color, was able to distinguish 6
species within that area, one of which (his Zamia integrifolia) ranges to
Florida. Landry (1993) in the influential Flora North America followed
Stevenson in recognizing the Florida plant as specifically distinct from

96 Phytologia (April 2009) 91(1)

the all-inclusive Z. pumila of Eckenwalder; Landry too employed Z.
integrifolia.

The present author has long been of the opinion that Zamia
integrifolia L. f. in Ait. (1789) was nomenclaturally superfluous when
published, in that Linnaeus filius (in Aiton) had erred (by modern rules)
by citing in his synonymy a pre-existing name, Zamia pumila L.
(1763). In this belief, the present author (1968; 1979; Burch et al.,
1988) has consistently used a later available name, Z. floridana A. DC.
(1868). In need of an infraspecific name for a non-typical Florida
population, he made the combination, Z. floridana var. umbrosa
(Small) D. B. Ward (2001). The authors of a recent, highly acclaimed
systematics text (Judd et al., 1999: 151) have accepted this judgment,
also using Z. floridana.

DISCUSSION

A circumstance has now arisen that compels presentation of a
full defense of Zamia floridana. The recent proposal by a colleague to
use this name in a floristic survey has by editorial review triggered an
intense reconsideration of its nomenclatural underpinnings. To satisfy
all parties that this name is correct calls for a full discussion of the
background facts and provisions of the International Code of Botanical
Nomenclature (McNeill et al., 2006) that justify this conclusion.

The facts of publication seem not in dispute. In 1763
Linnaeus published the name Zamia pumila. He accompanied the name
with a 7-word Latin phrase: Spadix more fructus Cupressi divisus in
floscules ("Infructescence [=cone] larger than [that of] Cupressus,
divided into florets [=?microsporophylls]"). He stated its source:
Habitat in America meridionali. He then listed four earlier authors (P.
Miller, J. Commelin ("Commelijn"), L. Plukenet, and C. J. Trew), with
the phrase-names used by each. Two centuries later the illustration of
one of these cited authors, that of Commelin (1697), was designated by
Eckenwalder (1980: 715) as the lectotype for Z. pumila.

Phytologia (April 2009) 91(1) 97

Linnaeus filius' treatment of Zamia was wholly independent of
that of his father. He is known to have worked in London with William
Aiton (Stafleu, 1971) and to have assisted in the writing of Aiton's
Hortus Kewensis (1789); each of the five descriptions of Zamia in that
publication was credited to him. In this endeavor he had access to
living plants (he noted Z. integrifolia to have been introduced from
"East Florida" by John Ellis in 1768). His description of Z. integrifolia
(foliolis subintegerrimis obtusiusculis muticis rectis nitidis, stipite
inermi) was original and appropriate to Florida plants. He cited only
one reference, the Z. pumila of his father, but for this he stated "exclusis
synonymis." This two-word Latin phrase is the genesis of all later
nomenclatural uncertainty regarding the Florida Zamia.

The third name involved here is Zamia floridana A. DC.
(1868). Its author reported it from "E. Florida" and its label data
(Eckenwalder, 1980) further narrowed its source to "Fort Brooke," a
Seminole War army encampment at the head of Tampa Bay on the west
coast of peninsular Florida, as collected by "Hulse." (In the 18th and
early 19th century, all of peninsular Florida was in the political district
of "East Florida." Gilbert White Hulse, a correspondent of John Torrey
in New York, was a physician known to have been stationed at Fort
Brooke.) The legitimacy of Z. floridana has not been challenged; but it
rises from synonymy only in the event of the illegitimacy of the prior Z.
integrifolia.

On the surface, Linnaeus filius' inclusion of an available name
would appear to trigger citation of I.C.B.N., Art. 52.1, which states that
if an old name cited in synonymy could have been used for the new
taxon, the new name is superfluous and illegitimate. Were Zamia
integrifolia illegitimate, the later Z. floridana would succeed.
Correspondents (largely via e-mail), however, have raised a number of
questions and arguments directed toward invalidation of the apparent
1.C.B.N. citation, in part by invocation of the related Art. 52.2, thus
retaining Z. integrifolia as legitimate. These communications have
been widely circulated within the taxonomic/nomenclatural community,
and have come to form a "gray literature" suggesting the validity of

98 Phytologia (April 2009) 91(1)

Zamia integrifolia is established. It is these questions and arguments
that must here be detailed and refuted.

Since the written (e-mail) statements of correspondents had
not been polished for publication, and at times perhaps exhibit whimsy
over precision, their specific authorship is withheld. Unattributed
statements, of course, are atypical within scientific discourse. To
mitigate the conflicting goals of confidentiality and verifiability, a full
copy of communications has been provided the editor. Where possible,
statements of correspondents are cited exactly, as indicated by
enclosure within quote marks.

The following eight arguments well summarize the range of
views expressed by the correspondents. The associated responses
attempt to relate these remarks with relevant provisions of the I.C.B.N.

Argument #1. That Linnaeus filius "meant to say just the
opposite, 1.e. ‘excluding Z. pumila L. except the synonyms.' Perhaps a
Latin scholar could refute my supposition that 'exclusis synonymis' can
be read as 'including only the synonyms.""

Response. No deep schooling in Latin is needed to know that
"exclusis" cannot be interpreted to mean "including only." The logic
and motive of Linnaeus filius in excluding his father's references is
apparent, in that some addressed quite different plants (one became
Zamia furfuracea L. f. in Ait.) and in any event were surely inferior to
the far greater wealth of materials (living and dried) available to him in
London.

Argument #2. That Eckenwalder's designation of the 1697
Commelin illustration as the lectotype of Zamia pumila, which
Linnaeus filius had excluded from his treatment of Z. integrifolia,
removes the critical element -- the type -- from the citation, thereby
expunging any prior superfluity.

Response. Eckenwalder's lectotypification is irrelevant in
determination of superfluity. If Zamia integrifolia were illegitimate
prior to Eckenwalder's designation, barring certain circumstances it
must remain so in perpetuity. Article 6.4 provides that: "A name which

Phytologia (April 2009) 91(1) 99

according to this Code was illegitimate when published cannot become
legitimate later" (unless conserved or sanctioned).

Argument #3. That Linnaeus filius had in effect created a
nomen nudum by exclusion of his father's cited references. [First
correspondent]: "When L. f. excluded all the synonyms of Z. pumila, he
automatically excluded all the type elements that would otherwise
cause the superfluity.". [Second correspondent]: "Since Aiton clearly
excludes the type of Zamia pumila of Linnaeus by excluding all the
synonymy of Z. pumila, he created a new and valid name, Zamia
integrifolia Aiton."

Response. This argument is in reference to Art. 52.2, the
companion of Art. 52.1, where conditions are set under which citation
of an old name in synonymy will cause the new name to become
superfluous. Citation of the name itself is specifically stated to be
sufficient to cause superfluity, "unless the type is at the same time
excluded either explicitly or by implication."

But with Zamia pumila no type existed at publication. Nor was
the legitimacy of that name impaired by its absence. Even without the
synonyms, the citation of Z. pumila still encompassed a full
circumscription: the name, the source, and the seven-word diagnosis.
At that time, 1789, no "type element" was essential for valid
publication; designation of a type was not required until 1958 (Art.
37.1). An abundance of early names, some by Linnaeus, many by
Rafinesque and Thomas Walter among others, are based solely (if
insecurely) on a name and its diagnosis.

Though there is a seductive logic in equating the references
cited by Linnaeus -- from which a later type-equivalent may be chosen
-- with a type itself, the provisions of Art. 52.2, read critically, do not
support the argument.

Argument #4. That a party other than the original author has
the power to cause the type of a name used in synonymy to be
excluded. That is, the requirements of the I.C.B.N. for a superfluity-

100 Phytologia (April 2009) 91(1)

causing synonym to be intentionally included are not met if a second
party can cause the exclusion.

Response. This argument, also in reference to the companion
Art. 52.2, though not expressly stated by any correspondent, is implicit
if the act of lectotypification can assign the type to a component of the
original material of Zamia pumila that Linnaeus filius had excluded.
Yet Art. 52.2 clearly indicates otherwise. Though the language is
passive -- "unless the type is at the same time excluded either explicitly
or by implication" -- there is no provision for parties other than the
original author to cause such exclusion. Nor, of course, can a later
party act "at the same time" as the original author.

Argument #5. [First correspondent]: That "Z. integrifolia is
not illegitimate because it did not include ALL the elements that might
become the lectotype. In short, it was not superfluous at birth."
[Second correspondent]: "Since Aiton's reference to Z. pumila excludes
all the synonyms (and their type materials), Z. integrifolia may be
treated as legitimate."

Response. Though differently worded, this argument is a
variant of Argument #3. Again, there is no requirement before 1958
that elements suitable for lectotypification be present. Had Linnaeus
(1763) published Zamia pumila as he did but without inclusion of any
references, the name would still be legitimate. The removal of his
references by Linnaeus filius (1789) creates no reduced state of
legitimacy.

It is obvious that the failure of an author to designate a
specimen that can serve as its type, or citation in his original materials
of other publications in which such specimens may be referred, creates
a significant uncertainty in assignment of the name to a definite taxon.
The I.C.B.N. addresses this deficiency, by the process of
neotypification (Art. 9.6). Where no specimen or suitable reference
exists, the rules permit a specimen never seen by the author to be
selected as a neotype. By this action a legitimate name that lacks clear
meaning can be linked with a specimen and thereby be made precise.

Phytologia (April 2009) 91(1) 101

Argument #6. "If the [lectotypic] element (Commelijn's t. 58
in this case) were to be included in any taxon published between 1762
[sic?] and 1980 (Z. integrifolia in this case), such an inclusion does not
cause illegitimacy (Art. 52, Note 2). ...L. f. did not include this element
for Z. integrifolia; therefore, the question of illegitimacy never arises."

Response. The thrust of this argument is not entirely clear.
The claim appears to be that by exclusion of the synonym the basis for
the name was also excluded. This view was supported by reference to a
rarely cited provision of the I.C.B.N., Art. 52.2, Note 2: "The inclusion,
in a new taxon, of an element that was subsequently designated as the
type of a name which, so typified, ought to have been adopted...does
not in itself make the name of the new taxon illegitimate."

The cited reference is irrelevant. A note as employed by the
I.C.B.N. does not create a rule or restriction; it merely clarifies the
meaning of the relevant Article. Plain reading of Note 2 creates no new
content; it says merely that a special stated circumstance does not make
the name illegitimate, though the implication is left that other
circumstances may still do so.

Argument #7. That the absence of known type material can be
interpreted to mean there never was such material, in which event
Zamia pumila would indeed be based on the cited references. "If there
were evidence from the protologue of Z. pumila that there must have
been original material, additional to that represented by the synonyms,
then even if this material is no longer extant, I would agree that this
situation would not meet the exclusionary requirements of Art. 52.2,
and Z. integrifolia would be illegitimate. But...this has not been
demonstrated."

Response. This argument is the most interesting and
potentially destabilizing of all offered. Whether or not Linnaeus had
seen living or dried materials of the West Indian cycad is not known.
He did not include the plant in his earlier (1737) treatment of plants he
had studied at Hartecamp, Holland (in which his solitary cycad, later
named Cycas circinalis, was placed between the palms Corypha and
Phoenix). And following his death, no specimen was present in his
herbarium (LINN).

102 Phytologia (April 2009) 91(1)

Linnaeus, however, did not employ a single word from the
phrase-names which he cited; his brief diagnosis was fully original.
Nor was his epithet, pumila, of prior use. And none would claim that
he saw nothing at Hartecamp other than those entities he knew well
enough to describe at that time. Even his herbarium, between his death
in 1778 and its arrival into the hands of Sir James Smith in 1784,
suffered losses of many damaged sheets (Stafleu, 1971: 113). It thus
cannot be ruled out that he may have been guided in whole or in part by
materials no longer extant.

Further, even if one were to assume the circumscription of
Zamia pumila had been entirely fabricated, the I.C.B.N. does not
provide for a distinction in treatment between such a baseless, illusory
name and one whose type material had been lost. Nor does the
I.C.B.N. require that evidence be provided that there had once been
original material. Again, the logic is seductive that such a difference
must call for different treatment. But in a real-world analysis it is
impossible to document this distinction, and instability would be the
only product of any effort to do so.

Argument #8. That it is best to retain Zamia integrifolia
because that name has been employed by some of the correspondents in
the past. "Z. integrifolia was accepted in Flora of North America vol. 2
(1993: 348). ...[f the name is illegitimate, it needs to be conserved with
a different type, for stability."

Response. This proposal, aside from its implied lack of
confidence by the correspondent, must be left to the judgment of other
parties.

CONCLUSION

No arguments have been put forward in support of Zamia
integrifolia that are firmly based on specific language of the I.C.B.N.
None, it would appear, can stand in contravention to the clear language
of Arts. 52.1 and 52.2, that an author's name is to be rejected if it was
nomenclaturally superfluous when published, and that superfluity is
caused by citation in synonymy of an earlier available name whose type

Phytologia (April 2009) 91(1) 103

was not excluded by the author. Zamia integrifolia L. f. in Ait. must be
interpreted under modern rules as a name that was illegitimate when
published and is unavailable for use either in Florida or in the West
Indies.

But a cautionary note stands before unequivocal acceptance of
Zamia floridana A. DC. as a replacement name for the Florida cycad.
DeCandolle's name is preceded by a series of other binomials
(Eckenwalder, 1980). Though none before Z. floridana is based on
Florida materials, the taxon also occurs widely in the Bahamas and
West Indies (Stevenson, 1987a). Should further investigation firmly
assign one of these earlier names to Bahamian or West Indian materials
of the Florida taxon, the Florida cycad may again require nomenclatural
attention.

ACKNOWLEDGMENTS

This essay is a consequence of the outpouring of thoughts and
judgments, both in support and in opposition, of James E. Eckenwalder,
Kanchi Gandhi, Bruce F. Hansen, Walter S. Judd, John McNeill, Guy
Nesom, Dan H. Nicolson, Bart M. Schulzman, Dennis W. Stevenson,
Billie Turner, and Richard P. Wunderlin, to whom I am indebted. The
e-mail file alone, transmitted through the courtesy of my colleague, W.
S. Judd, though somewhat inflated by repetitions and occasional
irrelevancies, has reached 18 pages of very small type.

LITERATURE CITED

Aiton, W. 1789. Hortus Kewensis 3: 478. London.

Burch, D., D. B. Ward and D. W. Hall. 1988. Zamia, in: Checklist of
the Woody Cultivated Plants of Florida. Institute of Food and
Agricultural Sciences, Univ. of Florida, Gainesville. Publ. SP-33.
80 pp.

Commelin, J. 1697. Horti Medici Amstelodamensis, pars prima. t. 58.
Amsterdam.

DeCandolle, A. 1868. Prodromus systematis naturalis regni
vegetabilis 16(2): 544. Paris.

104 Phytologia (April 2009) 91(1)

Eckenwalder, J. E. 1980. Taxonomy of the West Indian cycads. J.
Arnold Arbor. 61: 701-722.

McNeill, J., F. R. Barrie, H. M. Burdet, V. Demoulin, D. L.
Hawksworth, K. Marhold, D. H. Nicolson, J. Prado, P. C. Silva, J.
E. Skog, N. J. Turland and J. Wiersema, eds. 2006. The
International Code of Botanical Nomenclature (Vienna Code),
adopted by the 17th International Botanical Congress, Vienna,
Austria, July 2005. Regnum Veg. 146: 1-568.

Judd, W. S., C. S. Campbell, E. A. Kellogg and P. F. Stevens. 1999.
Plant Systematics. Sinauer Assoc., Sunderland, Mass. 464 pp.

Landry, G. P. 1993. Zamia, in: Flora N. Amer. 2: 347-349.

Linnaeus, C. 1737. Hortus Cliffortianus, 482. Amsterdam.

Linnaeus, C. 1763. Species Plantarum, ed. 2. 2: 1659. Stockholm.

Stafleu, F. A. 1971. Linnaeus and the Linnaeans. Utrecht,
Netherlands.

Stevenson, D. W. 1987a. Again the West Indian zamias. Fairchild
Trop. Gard. Bull. 42: 23-27.

Stevenson, D. W. 1987b. Comments on character distribution,
taxonomy, and nomenclature of the genus Zamia in the West
Indies and Mexico. Encephalartos 9: 3-7.

Stevenson, D. W. 1991. The Zamiaceae in the southeastern United
States. J. Arnold Arbor. suppl. ser. 1: 367-384.

Ward, D. B. 1968. Zamia, in: Checklist of the vascular flora of
Florida, Part I. Fla. Agric. Exp. Sta. Bull. 726 (tech.). 72 pp.

Ward, D. B., ed. 1979. Zamia, in: Rare and Endangered Biota of
Florida, vol. 5: Plants. Univ. Presses of Florida, Gainesville. 175

Pp.
Ward, D. B. 2001. New combinations in the Florida flora. Novon 11:
360-365.
Wunderlin, R. P. 1998. Zamia, in: Guide to the vascular plants of
Florida. Univ. Presses of Florida, Gainesville. 806 pp.
Wunderlin, R. P. and B. F. Hansen. 2000. Zamia, in: Flora of Florida,
vol. 1: Pteridophytes and Gymnosperms. Univ. Press of
Florida, Gainesville. 365 pp.

Phytologia (April 2009) 91(1) 105

MORUS MURRAYANA (MORACEAE):
A NEW MULBERRY FROM EASTERN NORTH AMERICA

Stephanie J. Galla, Brittney L. Viers, Paul E. Gradie,
and Dayle E. Saar

Department of Biological Sciences, Murray State University,
Murray, KY 42071 USA
dayle.saar@murraystate.edu

ABSTRACT

Mulberry trees (Morus: Moraceae) growing in relatively
undisturbed, open woodland areas of western Kentucky exhibit
exceptionally large leaves (blades often >15 cm long). Fruit size is also
longer than reported for other species, and leaf vein patterns are unique.
Field observations, combined with the use of herbarium specimens and
molecular data warrant the establishment of a new species designation,
Morus murrayana D.E. Saar and S.J. Galla (Murray State’s Mulberry).
Phytologia 91(1):105-116 (April, 2009).

KEY WORDS: Morus, Moraceae, mulberry, murrayana, Kentucky,
internal transcribed spacer, ITS

Mulberry trees (Morus L.: Moraceae) in western Kentucky and
the surrounding states, identified as M. rubra L., were observed with
exceptionally large leaves. In a search of plant keys (Jones, 2005;
Mohlenbrock, 2002; Wunderlin, 1997; Swink & Wilhelm, 1994;
Gleason & Cronquist, 1991; Radford et al., 1968; Steyermark, 1963;
Britton & Brown, 1913) and detailed, authoritative books (Kurz, 2003;
Dirr, 1998; Elias, 1987), only Wunderlin (1997) reported leaves of M.
rubra over 15 cm in length. He listed the usual size as 7.5-18 cm but
occasionally to 36 cm. Wunderlin assumed, based on his examination
of herbarium specimens, that the large leaves were due to shade/sun
forms or were perhaps associated with other growing conditions (pers.
comm. to DES). It should be noted that leaf size is only mentioned in
Wunderlin’s (1997) species description for M. rubra and he did not
include this feature in the diagnostic characters given in the keys for

106 Phytologia (April 2009) 91(1)

species identification. For the current study, the authors had the
advantage of first-hand field observations of these trees growing in
their natural habitat. Additional field data and DNA analysis
demonstrate that this is a separate species from M. rubra and all others
previously recognized.

MORUS MURRAYANA D.E. Saar and S.J. Galla, sp. nov. Fig. 1.

Arboles ad 20 m alto; folia alternatum, unifolius-quinquelobus, lamina
ad 38 cm longus, serrulatus; fructus ad 4 cm longus, nigellus purpureus.

TYPE: USA. KENTUCKY: Calloway Co. Frequent in open mesic
woodlands dominated by Quercus spp. and Carya spp. along both sides
of Watersport Rd. between gate to Racer Point and boat landing on
Kentucky Lake, near Hancock Biological Station, Murray State
University, ca. 25 km NW of Murray, KY (36° 43.87’ N; 088° 07.35’
W), 13 May 2006, Dayle E. Saar 3606 (Holotype: MUR; isotypes,
BEREA, BRIT, EKU, F, MO, NCU, NY, TENN, US).

Trees to 20 m tall with a single trunk, open crown vase-shaped to
rounded. Sap milky. Bark on saplings smooth, medium brown with
tan lenticels, becoming grayish-brown with very thin, long and narrow
scaly plates. Winter buds with pseudoterminal present, dull brown,
scales glabrous with minutely ciliated margins. Leaves alternate,
simple; stipules light brown, membranous to 1.1 cm long and early
deciduous; petioles 2.5-6 cm long; blades to 38 cm long, widest at or
below the middle, unlobed to as many as five lobes, caudate at tip and
oblique at base, serrate but occasionally double serrate, scabrous above
and softly pubescent on veins and lamina below, pubescence on larger
veins generally restricted to sides of veins, versus the dorsal peak (Fig.
1B); basal lateral veins larger than other laterals but smaller than the
midvein, veins branching from two large lower laterals (tertiary) and
other laterals from midvein (secondary) curve towards the tip as they
approach the blade margin without entering a tooth and only the finest
veins end in a tooth (Fig. 2C). Inflorescences of unisexual flowers
axillary on short peduncles; individuals varying from monoecious to
polygamodioecious to dioecious. Fruit multiple, blackish purple with
dark reddish-purple juice at maturity, to 4 cm long and 1.5 cm wide but
often thinner, with much variation in size on a single individual. The

Phytologia (April 2009) 91(1) 107

Figure 1. Morus murrayana with mature fruit showing variation in
leaf morphology (leaves not at maximum size when fruit begins to
mature); A. abaxial surface; B. adaxial surface. Scale bar = 5.0 cm.

108 Phytologia (April 2009) 91(1)

specific epithet, murrayana, was chosen to honor Murray State
University, Murray, KY (Murray State’s Mulberry).

Figure 2. Leaves of A. Morus rubra; B. M. alba; and C. M. murrayana
showing differences in veining patterns. Leaves not drawn to scale
with each other. See text for further descriptions.

GENERAL MORPHOLOGY AND NATURAL HISTORY

Many individuals of Morus murrayana were observed
growing in wet-mesic to dry-mesic open woodlands, in partly shaded to
sunny locations; the few individuals located in heavy shade were
growing poorly. They are virtually absent where Red Maple (Acer
rubrum L.) has come in under overstories dominated by oaks (Quercus
L. spp.) and hickories (Carya Nutt. spp.) and completely filled-in the
canopy. MM. murrayana occurs in natural as well as mildly disturbed
localities, but generally is not in high disturbance places such as fence
rows. Individuals observed for this study ranged in age from saplings
to large trees; none were stump-sprouts. In other words, no correlation

Phytologia (April 2009) 91(1) 109

has been detected between the large leaves and the trees’ age,
condition, and/or habitat including soil type.

The morphological extremes in blade shape can be observed
on the same branch next to each other. However, almost all trees
produce either >80% lobed leaves or are >80% unlobed; few
individuals display anything that approaches equal proportions of lobed
and unlobed leaves. In fall, the leaves turn medium yellow, the smaller
internal leaves falling first.

Trees produce either predominately staminate or carpellate
inflorescences, but the presence of some staminate inflorescences on
carpellate trees and vise-versa is common, especially on large saplings
and older individuals. Both staminate and carpellate inflorescences
may occur on the same large branch, usually separated on different
twigs. This is in contrast with M. rubra, which is monoecious (Elias,
1987; Jones, 2005). Fruit ripens in western Kentucky during June and
early July.

Morus murrayana has been sighted by one or more of the
authors in Kentucky, Tennessee, Missouri, and Illinois. Herbarium
specimens were also used to locate additional occurrences. Specimens
of M. murrayana were readily recognizable among the accessions
based on overall leaf size, caudate blade tips, and the venation pattern.
Specimens confirm that this species has existed or currently exists in
the four states personally documented by the authors, plus an additional
six states that include Indiana, Mississippi, Louisiana, Virginia, North
Carolina, and Alabama. The oldest specimen of M. murrayana
(identified as M. rubra) was collected in the southern Illinois city of
Carbondale in 1870. Other historical specimens date back to 1889,
1919, and 1937, in addition to those collected more recently. None of
the label descriptions indicate a disturbed habitat, although habitat
details were omitted on many labels. Most large-leafed specimens were
identified as M. rubra, presumably due to the similar pattern of leaf
pubescence. However, these trees were clearly problematic to
taxonomists. Some specimens were identified as M. alba L., a few
were listed as M. rubra x M. alba, and some had notations of “Morus
sp.” or “could not be determined.” Many had annotations different than
the original label identification (MZ. alba to M. rubra and vise-versa).

110 Phytologia (April 2009) 91(1)

OTHER SPECIES OF MORUS IN NORTH AMERICA

Morus consists of about 12 species (Mabberley, 1997), only
two of which (M. rubra and M. microphylla Buckley) are native to the
United States, Canada, and Mexico; other species are native to Asia
with some ranges extending west into Europe. M. microphylla is a
small shrub or small tree with leaves to 5 cm in length. M. murrayana
is most often confused with M. rubra. It can be distinguished from M.
rubra based on leaf vein pattern (Fig. 2), leaves longer than 15 cm with
caudate tips (vs. leaves <15 cm with cuspidate to broadly acute or
acuminate tips), and fruits longer than 3 cm (vs. <3 cm).

Another species, Morus alba, is naturalized from Asia and is
widespread in many areas of North America, as a result of escapes from
cultivation as a street planting and from an unsuccessful attempt in the
1830s to establish a silk industry in the United States (Federico, 1997),
as the leaves are used to feed larvae of the silkworm, Bombyx mori L.
M. alba has leaves that are shiny above and pubescence below is either
absent or scattered in vein axils or sparse along the larger veins.

Morus nigra L. and M. alba var. multicaulis (Perr.) Loudon
(syn. M. multicaulis Perr.) also have been documented in the US
(Wunderlin, 1997; Jones, 2005). Unlike M. murrayana, M. nigra has
dark brown bark and elliptic fruit to 2.5 cm long and wide (H. Sang,
2003). Further, Wunderlin (1997) reports that M. nigra, occasionally
cultivated in North America, is not known to naturalize. M. alba var.
multicaulis has leaves to 30 cm (L. Sang, 2003). However, the blades
are thick and wrinkled, which does not describe MZ. murrayana, and the
pattern of restricted pubescence below and glabrous above is consistent
with M. alba (not M. murrayana). Also, live specimens of M.
murrayana show no tendency for multiple trunks.

Plants of Morus rubra and M. alba are known to hybridize and
produce intermediate pubescence patterns on leaves, but they did not
produce large leaves and fruit (Burgess et al., 2005). MM. murryana was
not observed with M. rubra, but in the few instances where it occurred
in the vicinity of M. alba, intermediates were not present.

Phytologia (April 2009) 91(1) 111

MOLECULAR ANALYSIS AND COMPARISONS

Materials and Methods:

The entire herbarium collection of Morus at the Missouri
Botanical Garden (MO) was inspected for similar leaf and fruit
characteristics by DES.

Sequences for the internal transcribed spacer region (ITS) of
nuclear ribosomal DNA (nrDNA) are available in GenBank
(www.ncbi.nlm.nih.gov) for the species of Morus native to the Eastern
Hemisphere. For this study, DNA was extracted from two individuals
of M. rubra and three of M. murrayana using Quagen DNeasy kits.
Amplification was carried out following the protocol detailed in Saar et
al. (2003). DNA was sequenced in the DNA Core Facility at Northern
Illinois University, DeKalb, Illinois, on a Beckman-Coulter capillary
sequencer. All sequences of M. rubra and M. murrayana were aligned
with Clustal X software (Thompson et al., 2003). There were
differences between the sequences of M. rubra and M. murrayana, but
there was no intraspecific variation. Therefore, only one sequence of
M. murrayana was necessary for comparison to existing GenBank
accessions using a BLAST search (Altschul et al., 1990). The closest
matches from GenBank, together with the new sequences of M. rubra
and M. murrayana, were also aligned in Clustal X.

Results:

There were no herbarium specimens at MO with similar
morphological characteristics from any continent, except those
identified as Morus rubra.

The BLAST search indicates the closest species to M.
murrayana are M. macroura Miq., M. lhou Koidz., M. bombycis
Koidz., M. cathayan Hemsl., M. atropurpurea Roxb., M. alba, M.
nigra, M. australis Poir., and M_ multicaulis. Nucleotide
polymorphisms are summarized in Fig. 3.

DISCUSSION

From the list of species whose sequences most closely match
M. murrayana (Fig. 3), Morus atropurpurea, M. bombycis, M. lhou,

Phytologia (April 2009) 91(1)

112

‘soloods 104}0 9UO puk DU_ADAINUU SI 9Seq oNbiuN 4 ‘ouDADLINU PF SI dSeq onbIUN , :Sd}0N
“$79 OSE Je SUIBOQ BUDS S97 ‘Zp OSRq Je SUISOq
Z SLI ‘17 98eq Je suIdoq DUDS Gg'¢ ‘EG OSeq Je SUISOQ | SI] ‘WUoOWUSI]e sy) UT “sUOISsoDNR YURGUOH WOY sidyjO
‘Apnys sty} Woy vunddsiniu Jy pure vAqn4 PW JO sodUsnbog “YURGUdH Jo YoIkOS [SVT B UO poseq ‘punADLUNUL
SNAOP OJ SIQUINbIS yS9SO]I WoO soseq pousIye 179 Wo swsiydiowAjod opyoojonu o[8uls jo Arewmwng *¢ sandy

:
HK KKK KKK KKK KERR KKK KKH KKK HK > S8ION

7--990028323395-333.1093533905063 ee0656359---65 (euexkerrnu STSSO9rd
OLL--999999--OWOOLO-W9090 (eerndindo7z3e GPUISPEAY
DLL-99-9099--OWO9LO-wo09 (ezqnt 9TSSo9rd
DLL9DN999999--DWODLO-wOd9 (STTNeOTIT AW €007TPONY
DLL-9999999--DWODL9-wo09 (eznorOeW O007PONW
DLL-0809999--DVWODLO-W999 (ez6Tu ZOOZPONW
ODLL-90999999--OWOOLO-W909 (eqTe 8661 PONY
DLL-9999099--DWOOLO-W909 (NOYT 666 T PONY
ODLL-0999099--dvwo0ee-VO09 (sTTezqsne POOCPONY
DLL-9999999--OWOOLO-W999 (euehey eo TOOZ PONY
OLL-9999999--DWOOLO-W999 (sTOAquoq 9007PONY
GLODEESTETBITOEPCICESGO LOG HEC IOG8LOSHECBLIO9 1 (setoeds) ‘on yuequey!
TOOOO66LPEG6LLZTOSZE6EZTTIES88888LLLLLLLLOSEEZO

99999SSSSSDPPPPPEETZZZI10000000000000000000 -(*up Sutpesez) zequmy eseg

Phytologia (April 2009) 91(1) 113

and M. multicaulis are synonyms or varieties of M. alba (Ghafoor,
1985; Shu, 2003; Index Kewensis). All species from this list can be
separated from M. murrayana based on morphology. M. macroura has
yellowish-white fruit when mature, 6-12 cm long (Ghafoor, 1985; N.
Sang, 2003). (M. murrayana fruits are blackish-purple and < 4.0 cm.)
The Trade Winds Fruit Company (www.tradewindsfruit.com) reports
that M. macroura is only hardy to about 18-25°F (varies by individual).
Western Kentucky and southern Illinois are in USDA zone 6 (average
low of -10-0°F). M. cathayana has leaves 8-20 cm long, but they are
thick and papery and winter buds are white pubescent (S. Sang, 2003),
again, unlike M. murrayana. Morphologic distinctions from M. alba
and M. nigra have been discussed previously. The fruits of M. australis
are <2.5 cm long and plants are shrubs or small trees (Shu, 2003; J.
Sang, 2003) with twisted branches (Dirr, 1998).

In addition to M. alba, ten other species from Asia are
described in Flora of China (Shu, 2003). All species and varieties have
leaves < 15 cm except for M. nigra with 6-12(-20) and M. cathayana
with 8-20 cm leaves (both discussed previously). Four species are
included in the Flora of Pakistan. One of these species, M. serrata
Roxb. (syn. M. alba var. serrata (Roxb.) Bureau), which is confined to
the Indo-Pakistan subcontinent, has leaves 5-15 cm long. However,
this species has longer stipules (1.5-2.5 cm long) and smaller fruits
(0.8-2.5 cm long) (Ghafoor, 1985) than does M. murrayana.

The DNA sequence data separate M. murrayana from all
others in the GenBank database. Sequences of M. rubra and the Asian
species are similar, whereas M. murrayana has a notable 13-base
insertion plus five 1-2 base indels and 16 single base substitutions (Fig.
3). It is clearly the most distinctive sequence of the entire group.

Although it is somewhat unusual to describe a new, wide-
ranging, tree-sized species from the US, it is not without precedent.
Due in part to the fact that there are so few species of Morus found in
North America, very few characters are required to separate them. For
example, the most common sympatric species ranges include M. rubra
and M. alba, which can be separated based on leaf pubescence, thereby
eliminating the need to elaborate with additional descriptions. With so
few diagnostic characters utilized, M. murrayana falls within the

114 Phytologia (April 2009) 91(1)

parameters of virtually all plant keys for this genus in North America
and falls under M. rubra. Thus, skepticism may be minimal because it
is seemingly a good “fit” with the key. We have not observed M. rubra
growing with M. murrayana, which could have facilitated direct
comparisons. Further, with only two native species, Morus is not a
particularly attractive candidate for taxonomic study in North America.
The reputation of our native M. rubra may suffer due to a close
resemblance with its weedy, non-native congener, M. alba.

Further studies are underway to learn more about the natural
history of this species, and to produce a more detailed and extensive
distribution map.

Key to Native and Introduced Species in North America:

1. Leaves 2-5 cm in length, strongly bicolored (dull dark green

above, pale green below); shrubs or small straggly trees to

7 m; trees of the American SW and N Mexico. . . . M. microphylla
1. Leaves 3.8-14 cm long or longer, not strongly bicolored; trees. . . 2

2. Leaves glabrous above and often lustrous, glabrous below
or pubescence restricted to scattered hairs in vein axils or
scattered along larger veins; mature fruit white through pink
to'blackish purple. 5) swcy,t. eee. 1 SAM oro M. alba
2. Leaves scabrous on upper surface and soft pubescent below. . 3

3. Leaves with cordate bases; fruits elliptic to long ovoid, < 2.5 cm

long, maturing from red to black; landscape plant... . . M. nigra
3. Leaf bases variously oblique to slightly cordate; fruits
cylindrical and >2.5 cm long; mature fruits blackish purple... . . 4

4. Leaves to 15 cm long but often <10 cm, acute to acuminate
at tip, lateral veins (secondary) above lowest lateral fairly straight
and ending in a tooth; mature fruit to 3 cm long... . . M. rubra
4. Leaves to 38 cm long, outer three leaves on branchlets
almost always > 15 cm, caudate, lateral veins curve before
reaching margins, only tiniest veins end in a tooth; mature
fruit to 4 cm long and 1.5 cm wide but often thinner,
with much size variation on a single individual. . M. murrayana

Phytologia (April 2009) 91(1) 115

ACKNOWLEDGEMENTS

The authors thank Andrew M. Saar for the two technical
drawing figures and helpful observations on leaf venation patterns, the
Kentucky Academy of Science for funds to SJG and DES, and the
faculty Committee on Institutional Studies and Research at Murray
State University for funds provided to DES. W. Scott Grayburn
sequenced the DNA at NIU. Michael O. Saar assisted DES with the
inspection of specimens at MO. Two reviewers provided very helpful
comments on an earlier version of the manuscript. In addition to the
Murray State Univ. Herbarium (MUR), we are grateful for specimens
borrowed from the following herbaria: Missouri State Univ. (SMS),
Northern Kentucky Univ. (KNK), Southeast Missouri State Univ.
(SEMO), Southern Illinois Univ. (SIU), and the Univ. of Missouri,
Columbia (UMO).

LITERATURE CITED

Altschul S.F., W. Gish, and W. Miller. 1990. Basic local alignment
tool. J. Mol. Biol. 215: 403-410.

Britton, N.L. and A. Brown. 1913. An illustrated flora of the northern
United States and Canada, ed. 2. Dover reprint (1970), Dover
Publications, Inc., New York, NY.

Burgess, K.S., M. Morgan, L. Deverno, and C. Husband. 2005.
Asymmetrical introgression between two Morus species (M. alba,
M. rubra) that differ in abundance. Mol. Ecol. 14: 3471-3483.

Dirr, M.A. 1998. Manual of woody landscape plants, ed. 5. Stipes
Publishing L.L.C., Champaign, IL.

Elias, T.S. 1987. The complete trees of North America field guide and
natural history, Gramercy Publishing Co., New York, NY.

Federico, G. 1997. An Economic History of the Silk Industry, 1830-
1930, (Cambridge Studies in Modern Economic History)
Cambridge University Press, New York, NY.

Ghfoor, A. 1985. Moraceae. Flora of Pakistan, vol. 171, Missouri
Botanical Garden Press, St. Louis, MO.

Gleason, H.A. and A. Cronquist. 1991. Manual of vascular plants of
northeastern United States and adjacent Canada, ed. 2. The New
York Botanical Garden, Bronx, NY.

116 Phytologia (April 2009) 91(1)

Jones, R.L. 2005. Plant Life of Kentucky. University Press of
Kentucky, Lexington, KY.

Kurz, D. 2003. Trees of Missouri, C. Overby, ed. Missouri
Department of Conservation, Jefferson City, MO.

Mabberley, D.J. 1997. The plant-book, ed. 2. Cambridge University
Press, New York, NY.

Mohlenbrock, R.H. 2002. Vascular flora of Illinois. Southern Illinois
University Press, Carbondale, IL.

Radford, A.E., H.E. Ahles, and C.R. Bell. 1968. Manual of the
Vascular Flora of the Carolinas. University of North Carolina
Press, Chapel Hill, NC.

Saar, D.E., N.O. Polans, and P.D. Sorensen. 2003. A phylogenetic
analysis of the genus Dahlia (Asteraceae) based on internal and
external transcribed spacer regions of nuclear ribosomal DNA.
Syst. Bot. 28: 627-639.

Sang, H. 2003. Morus nigra. Flora of China, vol. 5, Missouri
Botanical Garden Press, St. Louis, MO.

Sang, J. 2003. Morus australis. Flora of China, vol. 5, Missouri
Botanical Garden Press, St. Louis, MO.

Sang, L. 2003. Morus alba. Flora of China, vol. 5, Missouri Botanical
Garden Press, St. Louis, MO.

Sang, N. 2003. Morus macroura. Flora of China, vol. 5, Missouri
Botanical Garden Press, St. Louis, MO.

Sang, S. 2003. Morus cathayana. Flora of China, vol. 5, Missouri
Botanical Garden Press, St. Louis, MO.

Shu, S. 2003. Morus. Flora of China, vol. 5, Missouri Botanical
Garden Press, St. Louis, MO.

Steyermark, J.A. 1963. Flora of Missouri. Iowa State University
Press, Ames, IA.

Swink, F. and G. Wilhelm. 1994. Plants of the Chicago region, ed. 4.
Indiana Academy of Science, Indianapolis, IN.

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin, and D.G.
Higgins. 1997. The CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Res. 25: 4876-4882.

Wunderlin, R.P. 1997. Morus [Moraceae] in Flora of North America
north of Mexico, vol. 3, pp. 390-392, Flora of North America
Editorial Committee, eds. Oxford University Press, New York,
NY.

Phytologia (April 2009) 91(1) 117

ANALYSES AND TAXONOMIC UTILITY OF THE
CEDARWOOD OILS OF THE SERRATE LEAF JUNIPERS OF
THE WESTERN HEMISPHERE

Robert P. Adams
Biology Department, Baylor University, Box 727, Gruver, TX, 79040
Robert_ Adams@baylor.edu

ABSTRACT

Analyses of the wood oils of the serrate leaf margined
Juniperus of the western hemisphere (21 species, 3 varieties and 1
form) are presented. All taxa have considerable amounts of cedrol,
widdrol, cis-thujopsene, a-cedrene and f-cedrene. In general, there was
little correlation between cedarwood oil compositions and phylogeny
in this section of Juniperus. Phytologia 91(1):117-139 (April, 2009).

KEY WORDS: Juniperus, Cupressaceae, wood oils, taxonomy, serrate
leaf, cedrol, widdrol, cis-thujopsene, a-cedrene and B-cedrene.

The serrate leaf margined junipers of the western hemisphere
appear to represent a natural sub-group of Juniperus (Adams, 2008). A
phylogenetic tree (Fig. 1) shows the relationships among these junipers
based on nrDNA and trnC-trnD sequences. These junipers evolved at
the margins of deserts in the southwestern US and Mexico. The
southwestern US - Mexico, the northern-Mediterranean, and central-
Asia - western China are the three centers of biodiversity of Juniperus.
The serrate leaf junipers appear to be the most recent species of the
genus (Adams, 2008). The group is composed of: J. angosturana R. P.
Adams, J. arizonica (R. P. Adams) R. P. Adams, J. ashei Buchholz, J.
a. var. ovata R. P. Adams, J. californica Carriere, J. coahuilensis
(Martinez) Gaussen ex R. P. Adams, J. comitana Martinez, J. compacta
(Mart.) R. P. Adams, J. deppeana Steudel var. deppeana, J. d. forma
elongata R. P. Adams, J. d. forma sperryi (Correll) R. P. Adams, J. d.
forma zacatacensis (Mart.) R. P. Adams, J. d. var. gamboana (Mart.)
R. P. Adams, J. d. var. patoniana (Martinez) Zanoni, J. d. var. robusta
Martinez, J. durangensis Martinez, J. flaccida Schlecht., J. grandis R.

118 Phytologia (April 2009) 91(1)

P. Adams, J. jaliscana Martinez, J. martinezii Perez de la Rosa, J.
monosperma (Engelm.) Sarg., J. monticola Martinez forma monticola,
J. m. forma orizabensis Martinez, J. occidentalis Hook., J. osteosperma
(Torr.) Little, J. pinchotii Sudworth, J. poblana (Martinez) R. P.

Adams, J. saltillensis M. T. Hall, and J. standleyi Steyermark.

serrate Juniperus

w. hemisphere
californica

Baysian tree
nrDNA + tmC-tmnD

monosperma

angosturana
coahuilensis
pinchoti

arizonica
occidentalis
grandis
osteosperma
saltillensis
compacta
deppeana

d. var. patoniana
d. f. zacatacensis
d. var. robusta

d. vat. gamboana
ashei

comitana
poblana
Standley
jaliscana
monticola
flaccida
durangensis
martinezii

Figure 1. Phylogenetic tree of the

serrate junipers (from Adams, 2008).

Although the leaf
essential oils of Juniperus have
been extensively utilized for
taxonomic purposes (Adams,
1991a; Adams, 2008), the wood
oils have not received much
taxonomic attention. Adams
(1987, Adams, 1991b) examined
the wood oils of junipers from
the United States as potential
sources of cedarwood oil and
reviewed the literature on early
analyses of Juniperus wood oils.

Commercial cedarwood
oils have been obtained from 3
genera of Cupressaceae:
Juniperus (Texas, Virginia and
African oils); Cupressus (China)
and Cedrus (Morocco, India)
according to Bauer and Garbe
(1985). However, Texas
(Juniperus ashei Buch.), Virginia
(J. virginiana L.) and Chinese
(putatively, Cupressus funebris
Endl.) cedarwood oils account
for almost all the cedarwood oil
commercially produced today
(Lawrence, 2003). The

heartwood oils of the Cupressaceae are well known for having the same
components across the family (i.e., evolutionally conserved), so the
occurrence of similar oils in different genera is not surprising. It is
probably due to the conservation of the principal commercially
important components (cedrol, widdrol, cis-thujopsene, a-cedrene and

Phytologia (April 2009) 91(1) 119

B-cedrene) that the wood oil compositions have not been utilized for
taxonomic purposes.

A second reason that wood oils have not been widely utilized
is the difficultly in taking samples. Leaf sampling does not harm a tree.
But to obtain a wood sample requires cutting down the tree, cutting off
a limb, or taking a coring sample. Taking tree cores is the least
destructive, but presents a problem if steam distillation is utilized to
obtain the wood oil, as a core sample consists of only a few grams of
wood and the oil can easily be lost on the walls of the steam distillation
apparatus. Comparison of steam distillation versus solvent extraction
using wood from the same tree (J. ashei) is shown in Table 1. Notice
that the highest yield was obtained from steam distilled wood shavings
and that 24 h of pentane extraction of wood chips removed only about
one- half of the oil obtained by steam distillation of wood shavings.
Using finely ground wood, resulted in about the same yield as using
wood chips.

Table 1. Comparison using J. ashei_wood for yields (oven dry wt basis)
and the concentrations of key components of oils obtained by steam
distillation (24 h), vs. various wood chip sizes and extractions with

pentane . ee a ae

steam Pentane extractions

distilled | woodchips wood from’ ground wood
variable shavings’ ext'd24h’ _re-ext'd +72h’ ext'd 24h*
per cent yield 3.7% 1.6% 1.6% 1.6%
a-cedrene 7.0 2.4 4.2 1.8
B-cedrene iy Int 2.0 1.0
cis-thujopsene 14.6 5.6 10.8 Did
cedrol 48.1 64.3 66.1 47.2
cis-thujopsenic acid 0.6 10.4 4.8 LI

‘shavings obtained from original wood, then steam distilled 24 h.
*wood cut into 25 mm x 3 mm x 3mm wood chips, pentane extracted by
shaking, 24 h. (# 9696)

*wood from Ist 24 h extraction (*), then the extracted wood chips were
ground in a coffee mill and a second, 72h, pentane (# 9697) performed.
“original sample wood ground in coffee mill, then pentane extracted
pentane for 24 h (#9700).

120 Phytologia (April 2009) 91(1)

None of the pentane extractions gave exactly the same results as the
steam distillation (Table 1). However, steam distillation can result in
decomposition (Adams, 1991b), whereas solvent extraction is a very
gentle method. This is shown in the marked increase of cis-thujopsenic
acid in the solvent extracts (Table 1). Free acids may be dissolved in
the steam condensate and return to the boiling chamber or they may
decompose during distillation (Adams, 1991b). If all the wood samples
are extracted in the same manner (ex. 24 h, shaking in pentane, cut to
uniform sizes), solvent extraction should produce a reasonable snapshot
of the profile of the wood oils.

The purpose of this paper was to present analyses of the wood
oils of all the serrate junipers of the western hemisphere and evaluate
these data for use as taxonomic characters.

MATERIAL AND METHODS

Samples used in the study: J. angosturana, 10.5 km e of Villa
Juarez (road from Cerritos to Rio Verde), thence s 1.3 km, San Luis
Potosi, Mexico, Lab # 9743 Adams 8714, J. arizonica, Rock Hound St.
Park, Luna Co., NM, Lab # 9725, Adams 7637, J. ashei, 1.6 km e of
Llano R., on I10, east of Junction, Kimble Co., TX, Lab #9721., Adams
5010, J. californica, 13 km n of 140 on road to Kelso, San Bernardino
Co., CA, Lab # 9750, Adams 5071, J. coahuilensis, 32 km n of Alpine,
TX, Jeff Davis Co., Lab # 9723, Adams 4994, J. comitana, 14 km s of
Comitan and thence 14 km e on rd to Montebello, Chiapas, MX, Lab #
9737, Adams 6862, J. compacta, near the summit of Cerro Potosi,
Nuevo Leon, MX, Lab # 9742, Adams 6898, J. deppeana var.
deppeana, 32 km nw of Ft. Davis on Tex 118, Jeff Davis Co., Lab #
9744, Adams 4983, J. d. var. gamboana, 17 km n of Comitan on Mex.
190, Chiapas, MX, Lab # 9735, Adams 6864, J. d. var. patoniana, km
152 on Mex. 40, 52 km w of El Salto, Durango, MX, Lab # 9738,
Adams 6838, J. d. var. robusta, west of Creel, Chihuahua, MX, Lab #
9728, Adams 6826, J. d. forma zacatacensis, 18 km w of Sombrerete,
between km 178 & 179 on Mex. 45, Zacatecas, MX, Lab # 9740,
Adams 6840, J. durangensis, nw side of Mex. 40, km 152, 52 km w of
El Salto, Durango, MX, Lab # 9749, Adams 6832, J. flaccida, 20-25
km e of San Roberto Jct., on Mex. 60, Nuevo Leon, MX, Lab # 9745

Phytologia (April 2009) 91 (1) 121

Adams 6892, J. grandis, at Sonora Bridge Campground Rd., 2 km w of
Jct of CA 108 and US 285 on CA 108, Mono Co., CA, Lab # 9734,
Adams 5061, J. jaliscana, 19 km e of Mex. 200, on road to Cuale,
Jalisco, MX, Lab # 9739, Adams 6846, J. martinezii, on La Quebrada
Ranch, 40 km n of Lago de Moreno off Mex. 85 to Amarillo, thence 10
km e on dirt rd to La Quebrada Ranch, Jalisco, MX, Lab # 9727,
Adams 8709, J. monosperma, 1.6 km w of Santa Rosa, on 140,
Guadalupe Co., NM, Lab # 9748, Adams 5028, J. monticola forma
monticola, 1 km n of jct of Mex. 105 and El Chico Natl. Park, on road
to El Chico Natl. Park (8 km ne of Pachuca), Hidalgo, MX, Lab #
9747, Adams 6874, J. occidentalis, 58 km w of Juntura on US 20,
Malheur Co., OR, Lab # 9724, Adams 5085, J. osteosperma, 25 km e of
Monticello, on US 666, San Juan Co., UT, Lab # 9741, Adams 5053, J.
pinchotii Sudw., 10 km w of Sheffield, on 110, Pecos Co., TX, Lab #
9722, Adams 5004, J. poblana, at KM 62 on Mex. 190, 62 km s of
Oaxaca, Oaxaca, MX, Lab # 9729 Adams 6871, J. saltillensis, 14 kme
of San Roberto Jct., on Mex. 60, Nuevo Leon, MX, Lab # 9726, Adams
6887 and J. standleyi, 24 km nw of Huehuetango on road to San Juan
Ixcoy (s of El Oro), Guatemala, Lab # 9746, Adams 6852. Vouchers
are in the herbarium, Baylor University (BAYLU).

Wood samples were radially cut in 1 cm segments using a
band saw. The radial sections were then cut linearly into 2 x 5 mm (x 1
cm) pieces. The wood (25 g) was placed in a 125 mL screw cap bottle
to which 50 mL of pentane was added. The bottles were shaken for 24
h on a rotary shaker. The pentane extract was filtered and the pentane
evaporated by use of nitrogen. The extracted wood was oven dried 48

h, 100 °C for use in the oven dry weight calculations. Percent yields
were determined on an oven dry weight basis as: 100 x oil wt./(oil wt. +
oven dry wood wt.). All oil samples (including commercial cedarwood
oils) were dissolved in diethyl ether (10% oil solution) and stored at -

20°C until analyzed.

The extracts were analyzed on a HP5971 MSD mass
spectrometer operated in the EI mode, scan time Isec., acquisition
mass range: 41-500, directly coupled to a HP 5890 gas chromatograph,
using a J & W DB-5, 0.26 mm x 30 m, 0.25 micron coating thickness,
fused silica capillary column, 0.2 wL injected of a 10 % solution in

122 Phytologia (April 2009) 91(1)

diethyl ether, and split 1/10, injector: 220 °C, transfer and MSD: 240

°C, column temperature linearly programmed: 60° - 246 °C/ 3 °C min.
Identifications were made by library searches of our volatile oil library
(10), using the HP Chemstation library search routines, coupled with
retention time data of authentic reference compounds. Quantitation
was by use of the HP Chemstation software. Normally one would
report the data as FID values, but considering the difficultly of the
peaks overlapping such that quantitation involved using single ion
chromatograms to estimated the concentrations (eg. cedrol/ widdrol,
etc.), it was not practical to quantitate the components by GC-FID.

RESULTS AND DISCUSSION

Tables 2 and 3 show the complete analyses of the cedarwood
oils of all 25 taxa of serrate leaf margined junipers of the western
hemisphere. Due to the use of a liquid extraction, considerable
amounts of cis-thujopsenic acid (and other acids) were present in the
extracts. It appears much of the cis-thujopsenic acid is degraded or left
in the water condensate during steam distillation (Table 1). Although
most taxa have considerable amounts of cedrol, widdrol, cis-
thujopsene, a-cedrene and f-cedrene, there are many un-identified
sesquiterpenoids. However, it is surprising to find such a large number
of un-identified compounds. Often, an un-identified compound was
present in only one or twice taxa. It appears that there may be
considerable synthesis of non-specific products in the wood. Keeling
and Bohlmann (2006) discuss the defense nature of terpenoids and note
that maintaining a diverse array of chemicals may be effective as a
plant defense.

The major components useful in commercial cedarwood oils
are cedrol, widdrol, cis-thujopsene, a-cedrene and f-cedrene. Table 4
shows the compositions of these five constituents in the 25 taxa of this
study. Notice that even in phylogenetically similar taxa (Figure 1,
arizonica, occidentalis, grandis and osteosperma), there is considerable
variation in the amounts of these components. In fact, it seems that
there is as much variation among these presumably closely related
species as among other more distantly related species (Table 4).

Phytologia (April 2009) 91(1) 123

The sum of cedrol, widdrol, cis-thujopsene, a-cedrene and f-
cedrene gives one some indication of the oils’ utility as cedarwood oil.
The sums range from 22% of the total oil (/. jaliscana, Table 4) to
70.4% (J. angosturana, Table 4). The species with low sums generally
have considerable amounts of unknown compounds. The percent
yields ranged from 0.04% (J. deppeana var. patoniana) to 3.4% (J.
standleyi). As a reference, the source of Texas cedarwood oil, J. ashei,
had a 1.7% oil yield. The product of the sum of the key components x
% yield (S x %, Table 4) is an index to the relative commercial
potential of a species. This index varied from 2.0 (J. deppeana var.
patoniana) up to 169.4 for J. angosturana with J. ashei having an index
value of 104.9. Although J. angosturana (169.4), J. d. var. gamboana
(128.6) and J. standleyi (143.1), all from Mexico, scored higher than J.
ashei from the United States (mostly Texas), they are generally not
found in large enough populations to sustain continued harvest of trees
for cedarwood oil. Juniperus arizonica, J. californica, J. grandis, J.
monosperma, J. occidentalis and J. pinchotii are weedy, widespread
junipers of the western US but these are either lacking a high
concentration of the key compounds or their percent yields are low and
do not appear suitable for commercial cedarwood oil production.

In conclusion, the cedarwood oils in this section of Juniperus
do not seem to be useful to taxonomy at the specific level. It would be
interesting to examine geographic variation within a species to
determine if the wood oils might be useful for populational studies.

ACKNOWLEDGEMENTS
Thanks to Tom Zanoni and Glenn Harris for assistance on the

field trips in Mexico and Guatemala. This research supported in part by
funds from Baylor University.

124 Phytologia (April 2009) 91(1)

LITERATURE CITED
Adams, R. P. 1987. Investigation of Juniperus species of the United
States for new sources of cedar wood oil. Econ. Bot. 41: 48-54.

Adams, R. P. 1991a. Analysis of Juniper and other forest tree oils. pp.
131-157. In: Modern Methods of Plant Analysis, New Series: Oil
and Waxes. H.-F. Linskens and J. F. Jackson, eds. Springler-
Verlag, Berlin.

Adams, R. P. 1991b. Cedarwood oil - Analysis and properties. pp. 159-
173. In: Modern Methods of Plant Analysis, New Series: Oil and
Waxes. H.-F. Linskens and J. F. Jackson, eds. Springler- Verlag,
Berlin.

Bauer, K. and D. Garbe. 1985. Common fragrance and flavor materials.
CVH Verlagsgesellschaft, Weinheim, Germany.

Keeling, C. and J. Bohlmann. 2006. Genes, enzymes and chemicals of
terpenoid diversity in the constitutive and induced defence of
conifers against insects and pathogens. New Phytologist 170:
657-675.

Lawrence, B. M. 2003. Essential Oils 1995-2000. Allured Publ., Carol
Stream, IL.

125

Phytologia (April 2009) 91(1)

Lew ¥ Sil
LO 660

}
10 i

Lo TO £0 #0
WoO —~4yeS 3ySOUeI

Td00

zie oul

ror TO oO 70
qeoo Osue ouour jijeo

ouoisueyo-¢
Jowiost ‘auaipesose-¢-1d9-¢ |
quaipesooe-¢
QuUdIpRloOde-1
ouoipesdoinyy
auasousey-¢-(q)
ouayeyoeuiy-0
audueZzZe Qos!
auosdofny)-sio
dudipso-¢
ououeizoidnp-¢
ouoiqounj-g-1do-7
QUdIPI9-0
ouafnyyinbsos
ouaiqounj-0
ououldisuol-¢g
ouofnyyinbsas-1do-/
ououeizoidnp-0
Joyjo [Ayo [OWA
joourd1a}-10
ouayeyjydeu
punoduio7)

6Lvl
OLVI
69V I
por
por
psvl
6rrl
9er I
6cr |
6lvl
elvl
liv
OIF
SOvl
cor
00rI
06€1
L8¢l
Cel
9811
8LII

IV

‘pjopdwuoa ‘f = dwiod ‘sisuazjijos “f= yes ‘pulsadsoajso ‘f= 9180 ‘SIpUDAS “f= URIS ‘81]/D]UAP1IIO “(= 1990
‘pouoziaD ‘f= Zire ‘mjoyouid ‘f= suid ‘sisuajinyvod “f= Yeod ‘puDANISOBUD ‘f= O8uR ‘DULJadsouoU ‘(=

OUOUL ‘DIIUAOfi]DI “f= fled ‘snAadIUNL PIARI| dJIIIS DY} WO S[LO pooMIEpsd Jo UOTISOdWIOD *Z 9[qeL

Phytologia (April 2009) 91(1)

126

yes

3JsO Uebel

ee)

]O1p9o-o][e
oprxo sua;AydoAyes
suojAusyduresisu0|

jouayja

auauaidns-9

OPIXOULIPII-p | ‘g
O7@7SOT'L6'EF [OusdsajInbsas

O77'S6 pr Ep [Ousdiayinbsas
Joyo 9UdOI]eII

suousidno-A

QUdUIPed-Q
QUOUDUIR]ed-SUPI}
,ouonjo} AxoipAy poyeyAjng

QUdYSP]e-10
auoredns
dudISTWeYd-0
ouorens-q-suet}
ouayeyoeuiy-g
audIppimopnasd
QUdUT]9S-10
auayse[e-g
auoulas-g
suaIp-p" | -B[BYoeuly-H-| |
auoyeyoeuiy-A
uodudUINdINI-1e

12F

Phytologia (April 2009) 91(1)

Iv

Cy] : : ; ; ol 80 St LO
g9 | ; : : 6S OF LIS 80
- 9'0 - -
co ¢ : : ‘je OO. OOe = i
Sele at A | ae 3 } m £0 SO Cb -90
CVS. OFF EOE BIVOLEr VE. 98ETLI O1S- Trl OM
i } } ~ Hole ‘Di Cy" = = } Le £00
2 C0: EO! oo 20 ; : i £0
Wo yes oySO uel qyeoo Osue OUOUT FI[ed

auaepes
077'16°69' Th [ousdiojinbsas
SIZ6IT16SOT [oucdioyinbsas
OTE THEI T [OusdsayInbsas
9ETSEL69'EP [euadioyinbsas
9ETS6'ETI EP [eUsdioyinbsas
jOopou9jul

9€7'69'16°SET [euodioyinbsas
O€TZ “ETI “Ep [euodsoyinbsas
OTZ‘6L‘SET [O-usduajzinbsas
[0-0 p-Ud- | [-UI]aS

jowsopno-0

[Owsopno-g

OTT IL*6 11 EP ‘Joucdioyinbsas
O77POT EST T [OUadro}INbsas
auouesdo{ny}-osi-¢
[eudipod-n-1d9-1p-/ ‘|
joud109e-¢

oud109R-0

07769 EF TTT [ousdioyinbsas
[o1pao-1da

Jooig-J

[O1po9

JOIPprAL

uoInAPW-OIpPAYIp-si9

SET LOT EP68T [Puadsajinbsas ¢6/]
O7T'SELIPETT Jousdsayinbsas 6g/ |
[0}SO09-1 ELLI

- PET LOI SS‘Tr [euodiayinbsas 99/ |
= [99s09- COL]
9'P Jouaipesose-g 79/1
80 jeussednd [SL]
- OCT LHI‘ P SOT [ousdiayinbsas | ¢/]
- PET Ty SSETT [euadsoyinbsas gp/ |
- SET TOL LPL STI [eusdsoyinbsas 67]
87 DET BITLEL EF [eusdiayinbsas 97/]
: Josayionu-(Z) pZLI
- C27 LOT SEE [ousdsayinbsas 9] L]
Tr TETLOT SEL EF SUodioyInbsas pL]
vE SIZ IP ETI feuediayinbsas 60/1
- jeuasdo{nuyi-sid BOL]
S81 ouoinkeul ¢0/]
- jouasdofny}-sid [QL]

- O77‘SOT6LSET [oUsdia}INbsas 669]

STZ O77SEL 16TH Jousdiayinbsas $69]

- joueipssiunf 769]

T7TTEL ITI Ep lousdiayinbsas 689]

2 > J0-€ [-USIPI9-g BgZol
0 “0. -—= Jojoqesiq-0 ¢gg]
SO =c0 1 Jojoqesiq-n-1da Egg]

Phytologia (April 2009) 91(1)

To00 Zie ould Yeoo Osue OUOU jI[ed

128

129

Phytologia (April 2009) 91(1)

yes aso

9ST SEL Eb TH ploe ‘dioyinbsos

PET LOL OCT TCI pise ‘unbsos

OST ISL ErSET euadioyinbsas

= uljeyj00U

pT IST ISI‘SEL Ep uadsoyinbsas
- PET LOLOEL TCL [eusdsoynbsas

9'0 plore o1uaredno
- PET TOL OCT TCT [eusdioyinbsas

- PET OPIETI TH [euadioqinbsas

OL PET LIT ETI TH [euadsoyinbsos
: [OIp-€ | ‘S8-ouRIps9

[Olp-p | ‘Sg-ouespoo

En ploe s1uasdofny}-sio
- [6p 191611 Puadsayinbsos

L'0 06161 1p uadsoynbsas
- O77‘SELSOLT6 [ouadsaqINbsas

Ol PET SOL16 GPT Ploe ‘JouNbsos
- joIpluswi0}d A195

80 PET SETS [euadsayinbsas
- PETLLIOEL TCH [euodsoynbsos

- OTTLLI9EI TCT [0 duoqnbsas

C1 TET TLI16°S6 Quodsoynbsos

- 9€Z7 LOT 681 ‘Eh [eusdsoyinbsas
- SITIP IE Spl [euodsoyinbsas

qeoo Osue ouour jITeo

Phytologia (April 2009) 91(1)

130

‘poyodas jou ore %¢"(— UR] SSo] S}JUDUOdWOD paljUapIUy) *(1) S9dRI} SB Po}OUSP av %]'()
uRY} sso] SonjeA [eUOTIsoduIoD “uUINJOD “(PSAs =) S-AC "UO xXepuy OHowIpIY = PY “onpoid yeinjeu-uoU B PosopIsuod
Ajyeuuiou st auanjoy AxospAy pare Ayng,, ‘suor Jofew aie suo! }xoU “poul|iapuN st (%00]) UO! aseq “spdo umouyun 104

JOUTSNISj-suely | EEZ
plow s1ouRdapeIDO QCIZ
- PETE EP SET plow ‘duoyinbsas 796]
wos [BS aySO- URI 1990 ZIIe =SUI yeoo Osue ouOou JI[Rd

131

Phytologia (April 2009) 91(1)

2S ea heen = Rp = =e = i Cen? <>
: | eo 400TCE 16

- - - - - C0 -

G04 GO O1P 60 L071 GOP TO YO OT GOT FT” 30 Oe
Je aed oe 4 BESO 62+ e213 Oe eee
i ee (COR. HIS — =~ = = MM = jE ‘2

CLOTS OL PITT CEP SISO Ser eer ere oe
- - - - - 10 - - - - - - - -
RO ble ee oe eee ee ee © ee eee
a ee ae Ree ae ee ROE P= C1 1
ere ee Pe ee eee eee ee
- - - - - - - v0 - - - - - -

ZOPLOL A Com Ae =- TOSI =F THSZO -PO* Hoe eo
A Grehe Cader) PETES = ee SE OT Me OVE ETO

feu inp oe juou el uejys [god ywoo syse wesp qoip sezp jedp

qolp ‘sisuaovywonz ‘f (p

aQuUdUeZZeQOSI
auasdofny}-sio

= : - ZO7LELITELZOl eucdiayinbsas

auoipas-q
aua||AydoAses-(q)
ououeizoidnp-g
QUdIP99-10
auofnyyinbsos
auoiqouny-0
auourdisuol-¢g
suafnyyinbsas-1d9-/
auoula|o-¢
ououeizoidnp-0
audiqounj-0-1d9-Z
Jo1oRAIBS
suayeujydeu
dUdUOUT|
auouiqes
auouid-0
punodui0;

jms sac us OO AE I ES A LEE ee

“NIZOUIJADUL * 7 =

‘sisuasuvAnp “f= Inp ‘pp1z9v]f “f= JBI “Djoojuow “f= yuOu ‘puposyol ‘f= wel ‘iajpunis ‘f= ueys ‘punjqod ‘f= jqod
“‘pUDIINMOD ‘[ = \WIOd ‘1aysD ‘f= dYse “DUDOqQUIDS “IRA ‘Pp ‘[ = WeSp ‘DISNGOA “IeA ‘P [=
‘pupiuojod “1eA ‘p ‘(= yedp ‘puvaddap ‘rf = ddap ‘snaadiune sorva] 918.98 WOLF S[1O POOAUIE

ff =
poo jo uontsodwoy *¢ a/qe,L

yew

oezp

Phytologia (April 2009) 91(1)

32

]

dey UO

ie!

Joya 9UIDI|e}I
ouausidns-A
QUdUIpPed-Q
QudUdWIe]ed-suRIy
guaulyas-n-1da-/
,ouan]o} AxoipAy poyeyAyng
ouourpes-A
QUdyse[e-0
ouoredno
dudISIWUeYo-0
ouayeyoeuiy-g
oudippimopnasd
QUdUI]AS-10
auayse[e-q
auoulas-g
dsudIp-p* | -B[BYoeUlY-H- | |
ouayeyoeurty-A
qudUdUUINIINI-1e
duois1wieyo-q
duaipelose-g
QUdIPeIONe-0
auarpesdofnyy
ouasautey-q-(q)
auayeyseuwiiy-0

133

Phytologia (April 2009) 91(1)

: . 90 jowsopno-g
- 90 OCT IL‘61 IEP [ousdiayinbsas

w 8 Se 3s <2e ee SO OR eh es = Oe
agg. < - - - - - . . - - - - [OT SPTLI‘Tp suadiayinbsas
at <6 Ve He 0. Hh ee Pepentniearnns
: 2 oF = - - - - - . - - - - 9€76L1PSET [euadsayinbsas
oY Tt OF OF v0 -ve OF VO-OT Loe rr cu i ol jouas0se-g
co of C7) CK SOLED Te cr or OF CE Cr VE Le Jousr0oR-0
ho os) te ee ee ee Se ep we ee me OS eS Ee eee
=. Wel 2) ws ee #4 ee GG us- = <8 20 -- hehe eR ers
im So Pt Tr co Fo oUF = so vO.S0 *" £0 TI Jorpao-ida
ws : : a. Vo <== cor = - => “jr & - - aprxo ouayeyoeurly-g
oo Se hy PRR BOs ROC ee 0 joroiq-g
OVE GIC GST POL TT 8% OIC Ter LOE TSS OC ET POLLS Jorpao
ve OS OE OL OOD TSz 90E - OCT TO OSI OST OL OCT JOAppIA
=. pO) EO £0 SHO £0 =<- % CO CO FO tO 10 uOINALL-OAPAU!P-SI9
oO Oe 1C OT tO OP CoO Tr ri Ss) £0 EO Ol £0 [orpoo-o||e
2 2 2 2 = F - : lo = - - - - jo-0z-uasdofnyy
- Z a . = = ¢H = - - - - - aprxo ouay[AydoAres
aoe = ~ 2 s : - - lo = - - - - auoudidns-Q
= Z'0 = Ore 20. = 10 - - - - - - - oplxouPIpss-p | “8
- : 2 - - - - - - - - - £0 T7ZZ69'SS*EF Jouddsaynbsos
Se de Se Se BS ee te IO PS: oe ee

OZZ‘SO7L6‘EP [ouUdsdioyInbsas

6r91
8P9l
0r9l
Or9l
8e9l
9¢91
peol
eco
cC9L
819
S19
C19
0091
661
S6Sl
6851
981
é8S 1
crs |
Ipsl
crs |
crs i

Phytologia (April 2009) 91(1)

134

dey juou

[O-¢ |-UdIpao-g

[o[oqesiq-0

[ojoqesiq-n-1do

0771661 I Tp Jousdiajinbsas
auat|AydoAreo
-(q)-1d9-6-AxoipAy-p |

SIT SOL Er ZST [2 duayinbsas

9€TS6 ETI ‘EP [euadsojinbsas
[Oopsuioyut

8891
$89l
€891
8991

8991
9991
S99
s99l

c0 suouRIpssiunl p99]
- SIT LSI Tp [eusdiayinbsas

LO 9E€T76L‘*SEI TH [euadsoyinbsas
9€7'18°6L ‘TH [euadiayinbsas

9ET 16 6L‘SET [eusdiajinbsas

SET BIT ETI EP [euodiajinbsas
SIT I6 Tr SE] [euodsojinbsas

O776L‘°SET [0-uadsayinbsas
[O-Dp-Us-]| | -Ul[asS
suouesdofnyi-¢

077‘LO1 69TH [ouedsayinbsas
joyeyoeuwiy

[OUIpeo-0

[0-0 | -U2-(¢ | )8-4pe9
077166 TH [ouadsayinbsas
punodui07)

y991
p991
£991
e991
e991
199]
0991
8S9I
esol
cs9l
cS9l
cS9l
0S9l
0s9l

135

Phytologia (April 2009) 91(1)

PET OIL E6611 [eusdsojinbsas
peT LOLSS‘TH [euadioyinbsas
[0}s09-¢

[OUdIPeIOR-g

SET E6 SIT [Puadsayinbsas

TZZ6L I P'SO] Jousdiajzinbsas
3 jeussedns

b0 O77 LEI‘ IP SOT [ousdiayinbsas
s ]01SO9-A
SIT TEL ETI Ep [euodioyinbsos

9ET ZO LEL6IT [esounbsas
9ETBITLEL EF [euadsayinbsas
josgjtonu-(Z)

C7T‘LOTSE IEF Jouadsaqinbsas
9ET9OT SS*ETI [Puadsayinbsas

TET LOT SEI EF Quadiayinbsas
OZZ8IT IP ETI [eusdsajinbsas
jeuosdo{ny}-st9

ouommAeUl

joussdofny}-si9

SIT 61116 ZOT [2 Jounbsas

9° ve I OZ@Z‘SOL6L‘°SET Jouadiaqinbsas
O77 IP IL'SET [euadiayinbsas

CUT TEL ITI EH [ouadsayinbsas

Phytologia (April 2009) 91(1)

136

oF OT!

0'l

£0

(6

v's

vo 9

prow s1uasdofny}-sio

L61€P 191611 ouodsajinbsas

- PET TOISOL6PT pioe Inbsas
- SOT EPETI [PUsdazinbsas
O'€ PET SOI16 GPT Plow “JoyINbsas
- PET S616 Tp [euodiaqinbsas
- 2u0}ey}00U
Ol PETLLE GEL TCL [eusdioyinbsas
9ET EP IT O8T fe duaqinbsas
OZTLLU9EL TCI [0° duayinbsas
JET SIT Sh 1 GBT [edioynbsas

9€T LOT 681 ‘EF [euddiaqinbsas
SITIP IE SPT [eusdiajinbsas

SITSOL6L‘16 [euediajinbsas
TET OLS STH [euadsayinbsas
9ET LOT EP S81 [Puddiayinbsas
PET EET 16681 [Puodioyinbsas
PET C6611 [Be duoqinbsas

SIT IP SEL TTI fe duayinbsas

PET O77 SII 6ST [2 duoynbsas
PET C6611 [Puodsajinbsas

dud[oinnw-0-AxOIpAY-p |
S£7'69' TPF 16 [euodsajinbsas
[0}S09-10

137

Phytologia (April 2009) 91(1)

Inp

dey juoU

yeh

PET LOL OE TCI poe ‘ynbsas

TET IOI OE TCI plow “nbsas
uljeyjoou

PET IS Ep‘SEl plow ynbsas

OST ISISEL Ep 9Uodiayinbsas

- PET EPILSLSST [e duayinbsas
90 PET IZ Er Ser [2 doyinbsas
OL PET L6l9EI TCI ploeynbsas
; PETIT 16 Th prose’ yinbsas
- PET ZOLSEL EP [e “duoqinbsas
- PET LOL ELI ‘SOT [e duoynbsas
Ol PET 6l9El TCI poe unbsas
- pT SEL IP TCT [edioyinbsas
PET LOL 9EL ETI [e duayinbsas
PET LOT IPETI [eusdiayinbsas
pET SOL‘89° Ep [euodisyinbsas

PET 6PLETI Th [eucdioyinbsas

PET 16 SOL GPT [e duoqnbsas

PET IOI LeI SOT [e duoyinbsas
[OIp-¢ [‘Sg-dueIps9
[OIp-p | ‘S8-oueIpso

- pee TET er OTT [e duoynbsas
60 PET 6IT LHI SOT [e diajinbsas

9€T'C6'SS ‘Ep [euadiajzinbsas
dyse Wiesp qolp

Phytologia (April 2009) 91(1)

138

a

yew

inp

(av

dey jUOW

He!

FOO, 0 c0

ues

}

ide

yuIOD oYse Wiesp golp

JOUISNLIOJ-sueI}

]01e}0}-SsuRy
jouuewuidoseiepues

ploe s1louvsape}90

ploe 19/0

PET EOT/TOT “Ep Suadsoynbsas
PET SOL 6P1 ‘6S [ediayinbsas
OST ISI EPSET plow” ynbsoas

Phytologia (April 2009) 91(1) 139

Table 4. Comparison of the major oil components among taxa.

ACDR = a-cedrene, BCDR = -cedrene, THJP = cis-thujopsene,

WDRL = widdrol, CDRL = cedrol, CTJA = cis-thujopsenic acid.

%yld = % yield on oven dry wt basis (oil/(extracted wood, dried 48h, 100°C).

ACDR_ BCDR_THJP WDRLCDRL Sum %yld Sx %
J. californica 1.2 DG 22s py AMD, MAT GSA: O.2 5.0

J. monosperma 0.7 0.5 SO ATA GTA eS less 'G:3 9.4
J. angosturana 1.4 O7 17S t 510° 70.6 24 169.4

J. coahuilensis tt 0.5 18.4 - 7.4 | Se. Bib 59.8
J. pinchotii 3.6 16 120. 42. 386 600 0.2 12.0
J. arizonica 1.9 0.6 . (145 o 76 B.L a277. 0.6 16.6
J. occidentalis 0.9 0.8 6.4 43.3 514 0.5 25.7

t
J. grandis 1.4 0.9" 154 - ALS Spo, 0.2 11.9
J. osteosperma 1.3 O97. 13.7 t 36.3 ° 520 O35 15.6
J. saltillensis {2 0:7 4 4)°930 t 46.9 57.8 0.1 5.8

J. compacta 0.4 0.4 25 - co: Fo alae pes lam 513
J. deppeana 7.6 2.0 9.1 12.0. 25.49" (564° “OS 16.9
patoniana 5 0.8 7.22 100 30.4 49.9 0.04 2.0
zacatacensis 4.1 14 WalOsr, AGIOS HES es3 ce NOs 16.6
robusta 3.9 0.9 G3 15-6151 200287) 7 20.1
gamboana 2.5 VO. 8 ON 55.2 ~C43 2:0, 128.6
J. ashei 0.6 04) 1200 120) “36:7 S67. 1.7 1048
J. comitana 0.5 0.2 2.9 - 43.2 468 1.0 46.8
J. poblana a 0.9 G6.~ 206) 21-0 9352.4 1-8 94.3
J. standleyi 2.6 2 “IOS. 252° 2:8 "a2. ssa Fast
J. jaliscana 2.6 Ot 1G 160 ri 220. aA 30s
J. monticola 1.9 OSS 14.3)". 70. VORA 345 O07 24.2
J. flaccida 3.5 1.0 4.8. 32.0 15:9" 57.2 09 51.5

J. durangensis re US) 73” S50. 219 30% "02 7.4
J. martinezii 2.0 OS M68) Sr S40. 474 te “Sse

140 Phytologia (April 2009) 91(1)

RELATIONSHIPS AND NOMENCLATURAL STATUS OF THE
NOOTKA CYPRESS (CALLITROPSIS NOOTKATENSIS,
CUPRESSACEAE)

Zsolt Debreczy
International Dendrological Research Institute
P.O. Box 812910, Wellesley, MA 02482
dendro@t-online.hu, dzsgy-2@rcen.com

Kathy Musial
Huntington Botanical Gardens
1151 Oxford Rd., San Marino, CA 91108

Robert A. Price
Biological Consulting
P.O. Box 448, Alameda, CA 94501

Istvan Racz
Hungarian Natural History Museum
H-1087 Budapest, K6nyves K. Krt.40

ABSTRACT

While working on the manuscript of Conifers Around the
World (in press), the authors encountered classification and
nomenclature questions surrounding the Nootka Cypress, originally
described as Cupressus nootkatensis D. Don, 1824. The combination
Callitropsis nootkatensis was later implicitly suggested for this taxon
by Oersted as the sole species in his new genus Callitropsis, but was
not published in accordance with the current International Code of
Botanical Nomenclature. The combination first appears in the literature
in Florin (1944), with the name attributed to Oersted, and was validated
by Little (2006), who treated the species as the type of a broader genus
including the New World lineage of Cupressus. The taxon has long
been treated as a species of Chamaecyparis, but this placement is
supported by only a limited number of non-unique morphological
characters and is not supported by more recent molecular comparisons.
Based on recent DNA sequence comparisons, the distinctive Nootka
Cypress can appropriately be treated in a monotypic Callitropsis, in a

Phytologia (April 2009) 91(1) 14]

ditypic genus with the Vietnamese Yellow Cypress (originally
published as Xanthocyparis vietnamensis), or in a larger generic clade
with the New World Cupressus. In the following paper we discuss its
complex nomenclatural and taxonomic history and morphological
distinctness. Phytologia 91(1):140-159 (April, 2009).

KEY WORDS: Callitropsis, Callitropsis nootkatensis, Cupressus,
Xanthocyparis, Nootka Cypress, Vietnamese Yellow Cypress.

BACKGROUND

In 2005, while working on the manuscript of Conifers Around
the World (Debreczy and Racz, in press), the authors came across
classification and nomenclature questions surrounding the North
American taxon well-known by its common names Nootka Cypress,
Alaska Cedar, Yellow Cedar, and Alaska Yellow Cedar (Little, 1980;
Rehder, 1940). In this paper we refer to it as Nootka Cypress, following
its original scientific name. It was first published as Cupressus
nootkatensis D. Don in Lambert, Descr. Pinus 2: 18, 1824, and has
subsequently been placed in three other genera: Chamaecyparis (1841),
Callitropsis (1864), and most recently, Xanthocyparis (2002). Due to
its combination of vegetative and reproductive characters sharing some
features with both Cupressus and Chamaecyparis, its taxonomic
position has long been debated, and its nomenclature has also been
subject to confusion.

NOMENCLATURE OF NOOTKA CYPRESS

Danish botanist Anders Sandoe Orsted (=Oersted; F ig. 1), ina
detailed, richly illustrated 1864 publication, considered the cone
structure of Nootka Cypress distinct enough from Chamaecyparis for
the taxon to be placed in its own genus, which he named Callitropsis.
Though Oersted gave a Latin diagnosis for the genus Callitropsis, and
assigned only Chamaecyparis nootkatensis (“nutkaensis”) to it, he did
not directly write out the new combination Callitropsis nootkatensis in
accordance with the International Code of Botanical Nomenclature
(ICBN) rules for pre-1953 publication of botanical names (McNeill et

142 Phytologia (April 2009) 91(1)

al., 2006). Therefore the combination was not validly published and
has been dealt with in a variety of ways by subsequent authors.

The genus name Callitropsis Oersted and the combination
Callitropsis nootkatensis were noted by (Carl) Rudolf Florin (1944)
when he published the genus name Neocallitropsis as an avowed
substitute for the later homonym Callitropsis Compton (Compton,
1922, p. 432). Though the name Callitropsis nootkatensis was
attributed to Oersted, it was apparently first written out by Florin
(1944), though not as a “comb. nov.” in accordance with the ICBN.
Little (2006) cited Florin as the author of the combination (see below),
apparently validating the name (Gandhi, pers. comm.). The name
Callitropsis nootkatensis Oersted was also cited by Erdtman and Norin
(1966) in a footnote in relation to its chemical distinctness from
Chamaecyparis, but not in a nomenclatural context.

The name Callitropsis nootkatensis then faded into obscurity,
and the species was widely treated as Chamaecyparis nootkatensis (D.
Don) Spach until evidence was obtained from tropolone and
biflavonoid chemistry (Erdtman and Norin, 1966; Gadek and Quinn,
1985) and from phylogenetic analyses of morphology and DNA
sequence data (Gadek et al., 2000; Farjon et al., 2002; Little et al.,
2004; Xiang and Li, 2005; Little, 2006) that the species was misplaced
in Chamaecyparis. Even though Florin's substitution of Neocallitropsis
for Callitropsis Compton was widely accepted, the basis of that change,
Oersted's name Callitropsis, was infrequently used in the literature until
Little et al. (2004).

When a new cupressoid conifer was discovered in karst areas
of northern Vietnam in 1999, it was soon described as the new genus
Xanthocyparis Farjon & H. T. Nguyén and species Xanthocyparis
vietnamensis Farjon & H. T. Nguyén (Farjon et al., 2002). These
authors found X. vietnamensis (Vietnamese Yellow Cypress) to be so
similar in cone morphology to Nootka Cypress that they included the
latter in the new genus and renamed it Xanthocyparis nootkatensis (D.
Don) Farjon & Harder. However, Little et al. (2004) pointed out that if
treating the two species as members of the same genus, the name
Xanthocyparis was invalid since Callitropsis Oersted had priority.

Phytologia (April 2009) 91 (1) 143

In February 2006 a proposal to conserve the name
Xanthocyparis against Callitropsis Oersted was published (Mill and
Farjon, 2006). Mill and Farjon, while also pointing out that Oersted did
not make the new combination in the current manner, acknowledged
that Callitropsis Oersted was validly published and that it should have
been adopted for the new Vietnamese conifer and Nootka Cypress,
making their publication of the name Xanthocyparis illegitimate
according to ICBN Art. 52.1 (McNeill et al., 2006). Thus the present
authors believe that the generic name Callitropsis Oersted should be
given continued priority over Xanthocyparis when the two species are
placed in the same genus, that Callitropsis Oersted is the correct
generic name for the Nootka Cypress when the genus is treated as
monotypic, and a monotypic Xanthocyparis is valid as its type is X.
vietnamensis, not Nootka Cypress. Although in 2007 the Nomenclature
Committee for Vascular Plants of the International Association for
Plant Taxonomy (IAPT) voted to recommend conservation of
Xanthocyparis over Callitropsis when the two species are placed in the
same genus (Brummitt, 2007), the present authors believe that use of
the much earlier generic name Callitropsis will cause no undue
problems and that the customary rule of priority should be applied.
Thus, this issue should be revisited before being voted on by the
broader membership of the IAPT at the Eighteenth International
Botanical Congress in 2011.

In October 2006, in a paper emphasizing phylogenetic
analyses of nuclear and chloroplast DNA as well as morphological data,
Little (2006) retained the generic name Callitropsis, but applied it to a
broader lineage including C. nootkatensis, Xanthocyparis vietnamensis,
and the New World lineage of Cupressus, a taxonomic judgment that
we discuss under “Generic Classification” below. In 2004 Little et al.
cited the combination as “C[allitropsis]. nootkatensis (D. Don) Oerst.
Apparently recognizing the problems with the publication of the
combination, Little subsequently (2006) attributed Callitropsis
nootkatensis to Florin. At the top of his Taxonomic Treatment, Little
appears to cite the type species of Callitropsis Oersted as “Callitropsis
nootkatensis (D. Don in Lambert) Florin, Regnum Veg. 100: 266.
1979.” Regnum Vegetabile 100 is the Index Nominum Genericorum
(Plantarum), in which the type of the genus name is listed as Cupressus
nootkatensis D. Don. The name Callitropsis nootkatensis does not

144 Phytologia (April 2009) 91(1)

appear there (Farr et al, 1979). Later in his list of combinations
recognized in the expanded genus Callitropsis, Little more
appropriately cites the species as “Callitropsis nootkatensis (D. Don in
Lambert) Florin, Palaeontographica, Abt. B, Palaéophytol. 85:590.
1944”, Florin (1944), as previously noted, did write out the
combination Callitropsis nootkatensis as a name from Oersted, but did
not formally propose it as a new combination, instead later referring to
the taxon as Chamaecyparis nootkatensis (p. 606, l.c.).

One can understandably regard Callitropsis nootkatensis (D.
Don) Oersted or Callitropsis nootkatensis (D. Don) Florin as implicit
combinations that were validly published under pre-1953 rules of the
ICBN (vide Articles 33.2 and 33.3, McNeill, 2006). However, the
combination did not appear in the International Plant Names Index
(IPNI) as of 31 December 2008. While preparing this manuscript, a
query from author Musial to a colleague to clarify a discrepancy in the
D. Don citation eventually led to Dr. Kanchi Gandhi of the Gray
Herbarium, Harvard University (also an editor for IPNI). An
unexpected outcome of the correspondence on 16 January 2009 was
that on 17 January 2009 “Callitropsis nootkatensis Oerst. nom. inval.”
and “Callitropsis nootkatensis Oerst. ex Florin” were posted to IPNI.
Further queries by Musial led Gandhi to maintain that the validity of
the Florin (1944) publication was questionable and that Little (2006)
might have inadvertently validated the name (Gandhi, pers. comm.).
The complexity of the issue led Gandhi to consult with other IPNI
editors and experts (see acknowledgements), and as of 26 January
2009, Callitropsis nootkatensis Oerst. ex Florin was also declared nom.
inval. and the name validated as Callitropsis nootkatensis (D. Don)
Florin ex D. P. Little, Syst. Bot. 31(3): 474, 2006; basionym Cupressus
nootkatensis D. Don in Lambert, Descr. Pinus 2: 18, 1824 (IPNI, 2009).
Little had formally recognized the taxon and cited its basionym in
accordance with ICBN Art. 33.4, 34.1, and 46.4 (McNeill, 2006).
Gandhi (pers. comm.) mentioned two alternative citations: Callitropsis
nootkatensis (D. Don) Oersted ex D. P. Little or Callitropsis
nootkatensis (D. Don) D. P. Little. Present authors preference is for
Oersted to be credited, and on 27 January 2009 Gandhi agreed and
amended the IPNI record to Callitropsis nootkatensis (D. Don) Oersted
ex D. P. Little (IPNI, 2009).

Phytologia (April 2009) 91(1) 145

GENERIC CLASSIFICATION OF THE NOOTKA CYPRESS

Generic delimitation in the Cupressaceae sensu stricto has
been more subjective than in most families of conifers due to the
limited number of reproductive and vegetative characters distinguishing
the approximately twenty currently recognized genera (Farjon, 2005).
DNA sequence comparisons have provided independent appraisals of
the relationships among these genera, and support a natural grouping
including the cypresses (Cupressus sensu lato), junipers, Nootka
Cypress, and Vietnamese Yellow Cypress (Gadek et al., 2000; Little et
al., 2004; Xiang and Li, 2005; Little, 2006). Within this lineage, ITS
sequence comparisons suggest that Nootka Cypress is the closest
relative of Vietnamese Yellow Cypress (Little et al., 2004; Xiang and
Li, 2005). This is consistent with the similarities in seed cone and
pollen cone morphology noted by Farjon et al. (2002), but the support
for a ditypic lineage comprising these two species is not strong in the
other phylogenetic analyses presented by Little (2006). Thus using a
total-evidence approach one can either recognize both as monotypic
genera, likely with a long separate evolutionary history but with limited
morphological differentiation, or treat them together as a ditypic genus.

There is strong support from several lines of DNA sequence
data for the inclusion of these two species in a broader phylogenetic
group also including an additional well-supported lineage, the New
World species of Cupressus (Little et al., 2004; Xiang and Li, 2005;
Little, 2006). This has been a surprise to morphological systematists,
since the New World Cupressus species are characterized by large,
many-seeded, serotinous (with few exceptions) seed-cones that are
retained for long periods on the shoots, and thus appear more similar to
the Old World species of Cupressus than to the Nootka Cypress and
Vietnamese Yellow Cypress. The molecular groupings are consistent,
however, with the fact that the Nootka Cypress is crossable with several
species of New World Cupressus (Jackson and Dallimore, 1926;
Mitchell, 1970). The widely grown Leyland Cypress (Chamaecyparis
nootkatensis x Cupressus macrocarpa) is apparently at least sometimes
fertile (Jackson and Dallimore, 1926), which is highly unusual for
conifers if these groups are regarded as separate genera, and also
suggests that they are closely related. Thus, Little (2006) has treated the
Nootka Cypress, Vietnamese Yellow Cypress, and New World

146 Phytologia (April 2009) 91(1)

Cupressus in a single genus as species of Callitropsis, a rather
unorthodox approach given the differences in morphology between
these taxa, but fully consistent with the molecular phylogenetic
groupings of the taxa without requiring a new generic name for the
New World cypresses.

From a macro-morphological aspect Nootka Cypress stands
out from both Cupressus and Chamaecyparis and it has distinct
differences from Xanthocyparis (see “Morphological Distinctness”
below). Nootka Cypress can be considered as a “chamaecyparoid”
cypress that, like Chamaecyparis, currently occurs in cold-temperate
climates; in the case of Nootka Cypress, specifically in cool-wet boreal
forests reaching as far north as 60°N. In submediterranean climates
(home to regionally adjacent “true cypresses”) it is restricted to cool
north slopes and high elevations where it even occurs as a groundcover
shrub (Griffin & Critchfield, 1976). Occurring from extreme
northwestern California to Alaska, Nootka Cypress is one of the most
northern-ranging members of the Cupressaceae. The species
traditionally placed in Cupressus (Old World as well as New World
lineages) often occur in zonal to extrazonal mediterranean or
submediterranean climates well reflected in their mostly small to
medium size and upright raceme-type branchlet system. The subtropical
or summer-rain tropical taxa of the genus that are adapted to humid
climates and face strong competition from broad-leaved angiosperm
trees are large trees with often pendulous fern-like sprays or filiferous
foliage, resulting in a relatively large assimilation surface and a rain (or
snow) shedding foliage system (e.g. Cupressus cashmeriana, C.
funebris, C. lusitanica).

MORPHOLOGICAL DISTINCTNESS OF NOOTKA CYPRESS
VERSUS CHAMAECYPARIS, CUPRESSUS, AND
XANTHOCYPARIS

Compared with Chamaecyparis (Fig. 2). Nootka Cypress is
similar to species of Chamaecyparis in having flattened branchlets,
conduplicate lateral scale-leaves, and small globose cones with few
basally developing seeds (2-4 per cone-scale). Nootka Cypress differs
significantly from all Chamaecyparis species in its wood and leaf
chemistry (Erdtman and Norin, 1966; Gadek and Quinn, 1985) and is

Phytologia (April 2009) 91(1) 147

placed outside of Chamaecyparis in a separate lineage with the
chemically more similar Cupressus and Juniperus in DNA sequence
comparisons (Xiang and Li, 2005; Little, 2006). Morphologically,
Nootka Cypress differs from Chamaecyparis in its uniform
amphistomatic adult scale-leaves without obvious white stomatal
patches on the down-facing sides of the branchlets, the whorl-like
arrangement of its 2(—3) pairs of cone-scales, without rudimentary
sterile terminal scale pairs but with a free cone-axis tip (columella), and
cones maturing in (1—)2 years. Chamaecyparis has strongly dimorphic
facial and lateral scale-leaves, stomata arranged in (pruinose) patches
on the down-facing side of the branchlets, cones with clearly
decussately developing (5)6—12 scales (3-6 pairs), with the 2-4
terminal scales sterile and connate to form a column (Jagel and Stiitzel,
2001). In its overall morphology, Nootka Cypress appears to be more of
a “chamaecyparoid” (mesomorphic) Cupressus-relative than a
cupressoid Chamaecyparis. The cones of Callitropsis nootkatensis (a,
fig. 2, top) have a conspicuous resin-filled conical extension
(columella) beyond the base of the terminal cone-scales, a feature
otherwise only typical of the Australasian genus Callitris and relatives
from Cupressaceae subfamily Callitroideae (inset: h, fig. 2, Callitris
rhomboide, 1: vasculature of Callitris preissii). In X. vietnamensis (b,
fig. 2, top) the columella is rudimentary (only a slightly raised area that
can barely be considered column-like). The other genera have a longer
cone-axis (relative to their cone sizes) associated with a usually larger
number of cone-scales with terminal cone-scales fertile (Cupressus), or
a few pairs form a sterile apical column.

Compared with Cupressus (Fig. 2). Nootka Cypress is
similar to the New World Cupressus species in having more or less
globose seed-cones often maturing in 2 years and adult foliage that is
uniform with amphistomatic scale-leaves. It differs in having relatively
small seed-cones (ca. 1 cm vs. 14 cm) that open in 1-2 years rather
than often being retained for long periods on the tree and opening in
response to fire. The cone-scales in Nootka Cypress are basifixed and
not heavily thickened, while they are medifixed (peltate) and often
much thickened and woody in Cupressus. Seeds are relatively few per
cone-scale (2-4), flattened, and broadly winged, versus many per cone-
scale (5-20), typically lenticular or faceted, and narrowly winged in
Cupressus. Pollen cones have only 2(-3) large pollen sacs per

148 Phytologia (April 2009) 91(1)

sporophyll, vs. 3-6 (up to 10 in C. macrocarpa) smaller pollen sacs in
Cupressus. DNA sequence studies (Xiang and Li, 2005; Little, 2006)
strongly indicate that the Nootka Cypress is a close relative of the New
World cypress lineage but there is no evidence that it or the related
Vietnamese Yellow Cypress is derived from within the New World
cypress lineage. Instead they are positioned as the closest outside
relatives, as suggested by the morphological differences.

Compared with Xanthocyparis vietnamensis (Figs. 3-4).
The Nootka Cypress is most similar to the Vietnamese Yellow Cypress
in having small more or less globose seed-cones (ca. 1 cm) with 2(—3)
pairs of cone-scales on a short axis (thus appearing in whorls) with
relatively few seeds per cone-scale (generally 2-4). The seeds of both
are flattened and have two thin lateral wings. The pollen cones have 2(—
3) relatively large pollen sacs per sporophyll. None of these shared
characters are unique in the Cupressaceae and thus they provide only
limited support for a distinct phylogenetic lineage consisting of these
two species (Little, 2006). The two species differ in several
morphological characters with uncertain phylogenetic importance such
as scale-leaf, cone, and seed properties but differ most prominently in
that leaves of both the needle-like juvenile form and scale-like adult
form are commonly found on adult trees of the Vietnamese Yellow
Cypress, and this is not the case in the Nootka Cypress or New World
cypresses. In Nootka Cypress the columella terminating the cone-axis is
usually evident, while it is very reduced or rudimentary in Vietnamese
Yellow Cypress (Figs. 3-4). The seeds are smooth in Nootka Cypress
but are conspicuously “warty” from tiny resin-blisters in Vietnamese
Yellow Cypress

DNA studies of the ITS region tend to support a close sister-
group relationship between these two species (Little et al., 2004; Xiang
and Li, 2005), but other DNA sequence comparisons place them near
one another in an unresolved trichotomy with the New World cypress
lineage. The lineage including Callitropsis nootkatensis has an
extensive fossil record in western North America dating back to ca. 50
MYA in the Eocene Epoch (Edwards, 1983, 1984). The chemistry of
the Vietnamese Yellow Cypress is apparently not yet studied, but based
on our current knowledge this would be unlikely to resolve generic
relationships in the group.

Phytologia (April 2009) 91(1) 149

At this time we choose to maintain Callitropsis nootkatensis
and Xanthocyparis vietnamensis as members of closely related
monotypic genera, which given their substantial geographic separation
have probably had long evolutionary histories. Further study may
provide new morphological or molecular characters that are uniquely
shared by these two species or these two plus the New World cypresses,
which would more strongly support a broader genus Callitropsis.

SUMMARY

The tortuous nomenclatural history of Callitropsis
nootkatensis has apparently been resolved and the combination
Callitropsis nootkatensis 1s now considered validly published and
should be attributed to (D. Don) Oersted ex D. P. Little. Xanthocyparis
is a valid name without need of conservation as long as the genus is
kept monotypic with X. vietnamensis as its sole species. The
morphological similarities between these two species, primarily in
seed- and pollen-cone structure, are not unique within the family and
thus may constitute only equivocal evidence in support of a separate
generic lineage. Thus from a classification standpoint, the Nootka
Cypress and Vietnamese Yellow Cypress are probably best considered
members of closely related monotypic genera (Callitropsis nootkatensis
and Xanthocyparis vietnamensis respectively) until stronger support of
their phylogenetic relationship is available.

ACKNOWLEDGEMENTS

Authors are grateful to Judy Warnement, Director of the
Harvard University Botany Libraries, for clarifying the D. Don citation
in Lambert’s Description of the Genus Pinus, and to Kanchi Gandhi of
the Gray Herbarium, Harvard University, and his colleagues at IPNI
and other experts for resolution of the Callitropsis nootkatensis
nomenclature (Werner Greuter and Eckhard Von Raab-Straube,
Botanischer Garten und _ Botanisches Museum Berlin-Dahlem,
Zentraleinrichtung der Freien Universitat Berlin; John McNeill, Royal
Botanic Garden Edinburgh; John H. Wiersema, Systematic Botany and
Mycology Laboratory, USDA/ARS, Beltsville, Maryland; John L.
Strother, University of California Herbarium, Berkeley). Thanks also
go to Duong Duc Huyen (Department of Botany, National Herbarium,

150 Phytologia (April 2009) 91(1)

Institute of Ecology and Biological Resources of the National Center of
Natural Sciences and Technology of Vietnam) for his assistance in the
fieldwork to document Xanthocyparis vietnamensis, and the Botanical
Library, University of Copenhagen, Denmark, for supplying Oersted’s
1864 paper and biographical information on him. Thanks to Emese
Barezi and Fanni Vamos for illustrations in Figure 3.

We are also grateful to Steve Edwards and Guy Nesom for
reviewing the manuscript and James P. Folsom for helpful comments.

LITERATURE CITED

Brummitt, R. K. 2007. Report of the Nomenclatural Committee for
Vascular Plants: 59. Taxon 56(4): 1289-1296.

Compton, R. H. 1922. A systematic account of the plants collected in
New Caledonia and the Isle of Pines. J. Linn. Soc. Bot. 45: 421-
434 + pl.

Debreczy, Z., and I. Racz. 2009 (in press). Conifers Around the World.
Budapest: Dendropress.

Edwards, S. W. 1983. Cenozoic history of Alaskan and Port Orford
Chamaecyparis cedars. Ph.D. diss., Univ. of California, Berkeley,
ZI App)

Edwards, S. W. 1984. New light on Alaskan and Port Orford
Chamaecyparis Cedars. Four Seasons 7(2): 4-15.

Erdtman, H., and T. Norin. 1966. The chemistry of the Order
Cupressales. Fortschritte der Chemie Organischer Naturstoffe 24:
206-287.

Farjon, A., T. H. Nguyén, D. K. Harder, K. L. Phan, and L. Averyanov.
2002. A new genus and species in Cupressaceae (Coniferales) from
Northern Vietnam, Xanthocyparis vietnamensis. Novon 12: 179-
189.

Farjon, A. 2005. A Monograph of Cupressaceae and Sciadopitys.
London: Royal Botanic Gardens, Kew.

Farr, E. R., J. A. Leissink, and F. A. Stafleu, eds. 1979. Index Nominum
Genericorum (Plantarum), vol. Il. Regnum Vegetabile 100.
Utrecht: Bohn, Scheltema & Holkema.

Florin, R. 1938-1945. Die Koniferen des Oberkarbons und des unteren
Perms. Palaeontographica 85B: 1-729. [The portion of this
multiyear publication that discusses C. nootkatensis is from 1944.]

Phytologia (April 2009) 91(1) 15]

Gadek, P. A., and C. J. Quinn. 1985. Biflavonoids of the subfamily
Cupressoideae, Cupressaceae. Phytochemistry 24: 267-272.

Gadek, P. A., D. L. Alpers, M. M. Heslewood, and C. J. Quinn. 2000.
Relationships within Cupressaceae sensu lato: a combined
morphological and molecular approach. Am. J. Bot. 87(7): 1044—
1057.

Griffin, J. R. and W. B. Critchfield. 1976. The Distribution of Forest
Trees in California. Res. Pap. PSW 82/1972 (reprinted with
Supplement, 1976). Berkeley: U.S.D.A. Pacific Southwest Forest
and Range Experiment Station.

IPNI. 2009. International Plant Names Index (list of date and place of
publication of plant names). Published on the Internet
http://www.ipni.org/ [accessed January 16, 2009, January 26, 2009,
January 27, 2009].

Jackson, A. B., and W. Dallimore. 1926. A new hybrid conifer. Bui.
Misc. Inform. 3: 113-115.

Jagel, A. and T. Stiitzel. 2001. Zur Abgrenzung von Chamaecyparis
Spach und Cupressus L. (Cupressaceae) und die systematische
Stellung von Cupressus nootkatensis D.Don [=Chamaecyparis
nootkatensis (D.Don) Spach]. Feddes Repert. 112(3-4): 179-229.

Little, D. P., A. E. Schwarzbach, R. P. Adams, and C.-F. Hsieh. 2004.
The circumscription and phylogenetic relationships of Callitropsis
and the newly described genus Xanthocyparis (Cupressaceae). Am.
J. Bot. 91(11): 1872-1881

Little, D. P. 2006. Evolution and circumscription of the true cypresses
(Cupressaceae: Cupressus). Syst. Bot. 31(3): 461-480.

Little, E. L. 1980. The Audubon Society Field Guide to North American
Trees, Western Region. New York: Alfred Knopf.

McNeill, J. et al. 2006. International Code of Botanical Nomenclature
(Vienna Code). Regnum Vegetabile 146. Ruggell: A.R.G. Gantner.

Mill, R. R. and A. Farjon. 2006. Proposal to Conserve the Name
Xanthocyparis Against Callitropsis Oerst. (Cupressaceae). Taxon
55(1): 229-231.

Mitchell, A. F. 1970. A note on two hybrid cypresses. Jour. Roy. Hort.
Soc. 95: 453-454.

Oersted, A. S. 1864. Bidrag til Naaletraeernes Morphologi,
Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening I
Kjobenhavn, Ser. 2, 6: 1-36 (Contributions to the Morphology of

152 Phytologia (April 2009) 91(1)

Conifers, Contributions to the Natural History Society of
Copenhagen).

Rehder, A. 1940. Manual of Cultivated Trees and Shrubs, 2nd ed. New
York: MacMillan.

Xiang, Q., and J. Li. 2005. Derivation of Xanthocyparis and Juniperus
from within Cupressus: Evidence from Sequences of nrDNA
Internal Transcribed Spacer Region. Harvard Pap. Bot. 9(2): 375—
382.

Phytologia (April 2009) 91(1) 153

Figure 1: Anders Sandoe Orsted (1816-1872), Danish botanist,
mycologist, zoologist, and marine biologist. In his long-overlooked
study of the differences in cone morphology of Chamaecyparis
nootkatensis and other cypresses he describes a new genus for Nootka
Cypress, Callitropsis. Photograph by Johannes Peterson, Courtesy of
the Botanical Library, University of Copenhagen, Denmark.

154 Phytologia (April 2009) 91(1)

Figs. 2-4 Comparison of Callitropsis, Xanthocyparis, Chamaecyparis
and the New and Old World Cypresses.

abbreviations: ad=adaxial; ab=abaxial; sd=seed; co/=columella;
trp=terminal resin pit; axrp=axillary resin pit; stcs=sterile terminal
cone-scale.

Figure 2. Longitudinal sections of cones and dissected cone vasculature
in Callitris, Callitropsis, Xanthocyparis, Chamaecyparis, and
representative New World (NW) and Old World (OW) Cupressus
species. (a) Callitropsis nootkatensis, (b) Xanthocyparis vietnamensis,
(c) Cupressus macnabiana (NW), (d) Cupressus macrocarpa (NW), (e)
Cupressus sempervirens (OW), (f) Chamaecyparis lawsoniana, (g)
Chamaecyparis obtusa var. formosana, (h) Callitris rhomboidea, note
that the columella is multi-parted for this species, (i) Callitris preissii.

Phytologia (April 2009) 91(1) 155

Figure 2. See caption on facing page.

156 Phytologia (April 2009) 91(1)

Figure 3: Selected morphological structures of A: Callitropsis
nootkatensis and B: Xanthocyparis vietnamensis. (a) Spray of mature
sun branchlets with detail of individual branchlet; (b) detail of shade
branchlet; (c) detail of leafy shoot, a leaf, and leaf surfaces from
juvenile plant; (d) leafy shoot and detail of leaf from persistent juvenile
foliage on mature tree of X. vietnamensis (not present in C.
nootkatensis); (e) conelet; (f) two perpendicularly oriented views of the
mature and unopened seed-cone; (g) longitudinal section of seed-cone,
showing columella in Callitropsis and elevated area as rudimentary
columella in Xanthocyparis and seeds; (h) seeds in lateral and facial
view showing warty resin-glands on the surface of X. vietnamensis
only.

137

Phytologia (April 2009) 91 (1)

Figure 3. See caption on facing page.

158 Phytologia (April 2009) 91(1)

Fig. 4: Selected morphological features of A: Callitropsis nootkatensis
and B: Xanthocyparis vietnamensis in photographs.

A: (a) juvenile branchlets from young plant; (b) semijuvenile foliage of
young plant; (c) shade and (d) sun branchlets of adult plant; the same
cone from (e) lateral and (f) axial views and (g) longitudinal section
with columella (arrow).

B: (a) juvenile branchlets from young plant; (b) juvenile-type foliage
from an adult plant; (c) shade and (d) sun branchlets of adult plant; the
same cone from (e) lateral and (f) axial views and (g) longitudinal
section with columella area with barely visible rudimentary columella
thinly filled with resin (arrow).

159

Phytologia (April 2009) 91(1)

Figure 4. See caption on facing page.

160 Phytologia (April 2009) 91(1)

A NEW GENUS, HESPEROCYPARIS, FOR THE CYPRESSES
OF THE WESTERN HEMISPHERE (CUPRESSACEAE)

Robert P. Adams
Biology Department, Baylor University, Box 727, Gruver, TX, 79040
Robert_ Adams@baylor.edu

Jim A. Bartel
U.S. Fish and Wildlife Service, Carlsbad Fish and Wildlife Office
6010 Hidden Valley Road, Suite 101
Carlsbad, CA 92011-4213

Robert A. Price
Biological Consulting
P.O. Box 448, Alameda, CA 94501

ABSTRACT

Phylogenetic comparisons of three nuclear DNA gene regions
(nrDNA(ITS), 4-coumarate: CoA ligase, abscisic acid-insensitive 3)
and a chloroplast region (petN-psbM) show that the Western
Hemisphere cypresses (Hesperocyparis) is a well-supported clade quite
separated from the Eastern Hemisphere cypresses (Cupressus). Based
on these new data and previous data, a new genus, Hesperocyparis, 1s
erected for the Western Hemisphere species previously placed in the
genus Cupressus (sensu lato). Hesperocyparis is most closely related
to the northwestern North American Callitropsis nootkatensis and the
southeast Asian Xanthocyparis vietnamensis. Morphological characters
distinguishing Hesperocyparis from CC. nootkatensis and X.
vietnamensis, and from the Eastern Hemisphere cypresses (Cupressus),
are presented. Phytologia 91(1):160-185 (April, 2009).

KEY WORDS: Cupressus, Callitropsis, Chamaecyparis,
Hesperocyparis, Xanthocyparis, Juniperus, ntDNA(ITS), 4-coumarate:
CoA Ligase, Abscisic acid-insensitive 3, petN, psbM, sequences,
taxonomy.

Phytologia (April 2009) 91(1) 16]

Attempts to identify and delimit coniferous genera have been
“based on limited sets of usually selective characters which were
perceived to be informative about evolution and/or phylogeny of the
group ... under study a priori” (Farjon, 2005). Despite the numerous
taxonomic works addressing the Cupressaceae (sensu lato), which were
described in detail by Farjon (2005), the modern concept of Cupressus
has remained largely unchanged for more than a century. However, the
discovery of a new conifer species on karst limestone in northern
Vietnam (Averyanov et al., 2002; Farjon et al., 2002) has led to both
excitement and taxonomic difficulties. Farjon et al. (2002) recognized
the taxon as a new species and genus, Xanthocyparis vietnamensis
Farjon & T. H. Nguyén, based on dimorphic leaves; small ovulate
cones with 2 or 3 pairs of opposite decussate cone scales; 2 years for
seed cone maturation; flattened, winged seeds; and juvenile, transition,
and adult leaves found on the same tree.

Farjon et al. (2002) concluded that Chamaecyparis
nootkatensis (D. Don) Spach was congeneric with X. vietnamensis and
included the former species in the new genus (overlooking the earlier
generic name Callitropsis Oersted) and made the new combination
Xanthocyparis nootkatensis (D. Don) Farjon & D. K. Harder.
Chamaecyparis nootkatensis has had a variable taxonomic history,
having been classified as Chamaecyparis, Cupressus, Callitropsis and
Xanthocyparis (see Little et al., 2004, and Debreczy et al., 2009 for
discussion).

Little et al. (2004), using nrDNA(ITS) internal transcribed
spacer (ITS) sequence data, found that Xanthocyparis vietnamensis and
X. nootkatensis form a clade sister to the Western Hemisphere
cypresses and that the Eastern Hemisphere cypresses and Juniperus
constitute distinct clades outside this group. Little et al. (2004) reported
that Chamaecyparis nootkatensis had been previously described as
Callitropsis nootkatensis (D. Don) Oersted in 1865. Little renamed _X.
vietnamensis as Callitropsis vietnamensis (Farjon and Nguyén) D. P.
Little. Though Silba (2005) did not address the molecular phylogeny
results, he did assert in response to Little et al. (2004) that the splitting
of western and Eastern Hemisphere cypresses was “based on superficial
data with inaccurate and incomplete field observations.” More
recently, Mill and Farjon (2006) made a proposal to conserve

162 Phytologia (April 2009) 91(1)

Xanthocyparis against Callitropsis. The Nomenclature Committee for
Vascular Plants voted 14-4 to recommend that the proposal be adopted
at the next International Association of Plant Taxonomists congress in
2012 (Brummitt, 2007). So, the matter currently remains unsettled (see
Debreczy et al., 2009, for discussion).

Xiang and Li (2005) reexamined Xanthocyparis,
Chamaecyparis, Cupressus and Juniperus using nrDNA(ITS)
sequences. Though the authors concluded that “it seems appropriate”
to place Xanthocyparis vietnamensis and X. nootkatensis in Cupressus
(sensu lato), they also noted that “Assuming the ITS tree reflects
species relationships, we need a new genus name for the New World
species of Cupressus if Xanthocyparis 1s recognized.” While Xiang
and Li (2005) submerged X. vietnamensis in Cupressus, the
combination Cupressus vietnamensis was made previously by Silba
(2005) and remade later by Rushforth (2007).

Prior to the recent spate of publications described above,
taxonomic work on Cupressus largely was focused on the specific and
infraspecific level with considerable disagreement as to the number of
distinct species to recognize in the genus (see Wolf, 1948; Little, 1970;
Farjon, 2005). The classical monograph by Camus (1914) treated the
known species of Cupressus on a worldwide basis and also included the
distinct but related Chamaecyparis as a subgenus of Cupressus. The
most thorough morphological treatment of the Western Hemisphere
species of Cupressus is the revision of Wolf (1948), who only included
the New World species in his study on the grounds that the Eurasian
and African species were not readily accessible for detailed population-
based field studies. He also stated that “none of [the Old World
species] appears closely related to our New World species.”

Silba (1983), after reportedly raising seedlings of the 25 taxa
he delimited, noted consistent differences in cotyledon number and
shape in all Western versus Eastern Hemisphere cypresses (cotyledons
3-4 and acute, versus 2 and obtuse), though he did not think these
characters, alone, warranted dividing Cupressus into subsections.
However, Silba (1994, 1998) later arranged Cupressus into two
subgenera and seven sections, and designated Cupressus lusitanica as
the type for his new subgenus, /ndoamericana, which included Western

Phytologia (April 2009) 91(1) 163

Hemisphere taxa of Cupressus with some additional Asian species. The
name of this subgenus, /mdoamericana, reflects the generally
discredited belief, which Silba (2006) continues to support, that C.
lusitanica (which occurs in the wild in Mexico and central America)
actually originated in Goa, India, from where seed was purportedly
collected and introduced into Portugal (Farjon 1993). Apart from this
problem, Silba’s (1994, 1998) treatment would place some species in
multiple sections (Little, 2006).

Little (2006) expanded the scope and depth of his previous
work (Little, et al., 2004) and analyzed cpDNA (matkK, rbcL, and trnL)
plus two nuclear gene regions: nrDNA(ITS), and NEEDLY for all 16
species of the Western Hemisphere and 12 species of the Eastern
Hemisphere (Cupressus, sensu lato). The portions of his trees relating
to Xanthocyparis, Cupressus, and Juniperus are depicted in figure 1.

imatK, roel, tnt '! nrDNA (ITS)

99 Juniperus 7 Eastern Hemisphere cypresses

Eastern Hemisphere cypresses : Juniperus

X. vietnamensis
C. nootkatensis

X. vietnamensis
C. nootkatensis i
90 Western Hemisphere piginicie

"Combined ‘Molecular 4 + “Morphology _ ,
X. vietnamensis + 700 Western Hemisphere CYPIESSOS:
C. nootkatensis i __3°X. vietnamensis
Western Hemisphere cypresses || --C. nootkatensis

700 Juniperus

Figure 1. Summary of partial trees extracted from data of Little (2006).
Numbers below the branches are strict consensus jackknife frequencies
above 50%. Dashed lines in the Combined Molecular + Morphology
tree for C. nootkatensis and X. vietnamensis indicate branches that are
collapsed in the strict consensus.

164 Phytologia (April 2009) 91(1)

Little (2006) obtained strong support for the Western
Hemisphere cypresses as a monophyletic clade in the analyses of each
of his molecular data sets. In addition, there was strong support (Fig. 1)
that the closest relatives of Western Hemisphere cypresses are
Xanthocyparis vietnamensis and Callitropsis nootkatensis. The
Western and Eastern Hemisphere cypresses, and Juniperus are each
well resolved as distinct clades in each of his molecular analyses, while
X. vietnamensis and C. nootkatensis form an unresolved trichotomy
with the Western Hemisphere cypresses in the cpDNA and NEEDLY
analyses, and are only moderately well supported (61%) as a 2-species
clade in the ITS analysis (Fig. 1). A tree based on morphological data
failed to separate eastern from Western Hemisphere cypresses, but a
combined analysis of the morphological and molecular data sets did
strongly separate these geographic groups (Little, 2006, Fig. 1 above).
The results of the molecular and combined analyses also provided
strong evidence that C. /usitanica is nested well within the Western
Hemisphere group, whereas C. torulosa is definitely placed within the
Eastern Hemisphere lineage contrary to the subgeneric classification of
Silba (1994).

In addition to the previously mentioned response to Little et al.
(2004) by Mill and Farjon (2006), Farjon (2007) in a letter to a Taxon
took issue with Little’s 2006 paper because Farjon maintained that the
only significant morphological difference between the Western and
Eastern Hemisphere cypresses, cotyledon number, did not hold for two
Asian species, C. chengiana and torulosa. Farjon (2007) concluded
that there “are no morphological or anatomical differences that justify
this generic separation.” While acknowledging that “No single
characteristic can be used diagnostically,” Little (2006) stated that a
suite or “series of vegetative characteristics possibly associated with
adaption to arid environments (e.g., monomorphic leaves, penultimate
and ultimate segments arranged on two planes) unite the New World
Cupressus species to the exclusion of Old World Cupressus, Juniperus,
and Callitropsis [sensu stricto].”

Little (2006) decided to include the Western Hemisphere
cypresses (Cupressus) in Callitropsis and published 17 new names
from North America. Little (2006) reasoned that giving a new genus
name to the Western Hemisphere cypresses (as suggested by Xiang and

Phytologia (April 2009) 91(1) 165

Li, 2005) would be “consistent with some but not all resolutions of the
polytomy between Callitropsis [i.e., X. vietnamensis and Ch.
nootkatensis| and the New World Cupressus species.” However, only
the ITS data (Fig. 1) present X. vietnamensis - C. nootkatensis as a
clade and Little’s results did not provide any strong evidence against
placing these two taxa in a separate genus (as suggested by Farjon et
al., 2002 and Little et al., 2004) or as monotypic genera as suggested by
Debreczy et al. (2009).

In an effort to add additional molecular data to the taxonomic
questions, we have sequenced two nuclear genes (4-coumarate: CoA
ligase, 4CL and abscisic acid-insensitive 3, ABI3, as well as complete
nrDNA(ITS) sequences for additional taxa and a cpDNA region, petN-
psbM.

The 4-coumarate: CoA Ligase (4CL) gene family is important
in phenylpropanoid synthesis leading to lignin, as well as flavonoids,
and other pigments as well as phenolic compounds in essential oils such
as safrole, eugenol, etc. (Hamberger and Hahlbrock, 2004; Cukovic et
al., 2001) Recently, Peng and Wang (2008) utilized 4CL sequences to
study Thuja species and Thujopsis dolabrata. In Thujopsis dolabrata
they found the 4CL gene to be composed of 4 exons and 3 introns.
Intron 2 was reported as 640 bp (EU183423). Aligning the GenBank
sequences for Thuja plicata (EU183418, EU183417) and Thujopsis
dolabrata (EU183423) enabled us to design primers to span intron 2,
and resulted in 746 - 823 bp of sequence data.

Lazarova, Zeng and Kermode (2001) reported on the
occurrence of an abscisic acid-insensitive 3 (ABI3) gene homologue
from Chamaecyparis nootkatensis (CnABI3). The ABI3 gene is
composed of six exons and five introns, with the intron sizes of 105,
113, 110, approx. 1000, and 142 bp. Primers were designed in exon 4
and exon 5 to amplify intron 4 (see Materials and Methods below) and
resulted in 1020 - 1108 bp of sequence data.

The cp region trnC-trnD has been used in phylogenetic studies
in Juniperus (Adams, 2007; Adams et al., 2007). The partial sequence
utilized in this study is the petN - psbM region (included in the trnC-
tmD region). This region is much easier to amplify and resulted in

166 Phytologia (April 2009) 91(1)
approximately 807-854 bp compared to 1400 - 1500 for the full trnC-
trnD region.

The purpose of the present study is to bring additional
molecular data to bear on the question of the taxonomic status of
Xanthocyparis, versus the Eastern and Western Hemisphere cypresses.

MATERIALS AND METHODS

Specimens used in this study:

Species Voucher Source GenBank
X. vietnamensis

nrDNA(ITS) Little et al. 2004 Vietnam AY 380877
ACE Rushforth 7745 Vietnam FJ744493
CnABI3 Rushforth 7745 Vietnam FJ56803
petN-psbM — Rushforth 7745 Vietnam FJ46729
C. nootkatensis

nrDNA(ITS) Little et al. 2004 AK, USA AY380858
4CL Adams 9086 WA, USA FJ744494
CnABI3 Adams 9086 WA, USA FJ56803
petN-psbM Adams 9086 WA, USA FJ46730
C. atlantica

nrDNA(ITS) | Little et al. 2004 Morocco AY 988367
4CL Adams 8429 Morocco FJ744495
CnABI3 Adams 8429 Morocco FJ56805
petN-psbM Adams 8429 Morocco FJ46731

C. dupreziana,

nrDNA(ITS) Little et al. 2004 Algeria ex Hillier Gard. AY988375
4CL Adams 8432 Algeria ex Hillier Gard. FJ744496
CnABI3 Adams 8432 Algeria ex Hillier Gard. FJ56806
petN-psbM Adams 8432 Algeria ex Hillier Gard. FJ46733
C. sempervirens,

nrDNA(ITS) Adams 8434 Elburz Mts., Iran FJ705221
4CL Adams 8434 Elburz Mts., Iran FJ744497
CnABI3 Adams 8434 Elburz Mts., Iran FJ56807

petN-psbM Adams 8434 Elburz Mts., Iran FJ46732

Phytologia (April 2009) 91(1)

H. abramsiana

167

nrDNA(ITS) Adams 9354 CA, USA FJ705220
4CL Adams 9354 CA, USA FJ744498
CnABI3 Adams 9354 CA, USA FJ56808
petN-psbM Adams 9354 CA, USA FJ46737
H. bakeri

nrDNA(ITS) Little et al. 2004 CA, USA AY988369
4CL Adams 9362 CA, USA FJ744499
CnABI3 Adams 9362 CA, USA FJ56809
petN-psbM Adams 9362 CA, USA FJ46739
H. pygmaea

ntDNA(ITS) Adams 9357 CA, USA FJ705219
4CL Adams 9357 CA, USA FJ744500
CnABI3 Adams 9357 CA, USA FJ56810
petN-psbM Adams 9357 CA, USA FJ46738
J. monticola

nrDNA(ITS) Adams 6876 HID, MX FJ705218
4CL Adams 6876 HID, MX FJ744501
CnABI3 Adams 6876 HID, MX FJ56811
petN-psbM Adams 6876 HID, MX FJ46736
J. saltillensis

nrDNA(ITS) Adams 6886 NL, MX FJ705217
4CL Adams 6886 NL, MX FJ744502
CnABI3 Adams 6886 NL, MX FJ56812
petN-psbM Adams 6886 NL, MX FJ46735
J. virginiana

nrDNA(ITS) Adams 6753 TX, USA EF608980
4CL Adams 6753 TX, USA FJ744503
CnABI3 Adams 6753 TX, USA FJ56813
petN-psbM Adams 6753 TX, USA FJ46734
Thujopsis dolabrata

nrDNA(ITS) Peng and Wang Jiangxi, China EU183443
4CL Peng and Wang Jiangxi, China EU183423
CnABI3 Adams 9502 Japan ex Arn. Arb. FJ56814
petN-psbM Adams 9502 Japan ex Arn. Arb. FJ46727

168 Phytologia (April 2009) 91(1)

Thuja plicata

nrDNA(ITS) Adams 9277 Vancouver Isl., BC AY380852
4CL Peng and Wang Kew Bot. G.ex USA? EU183417
CnABI3 Adams 10311 Queen Charlotte Isl., BC FJ56815

petN-psbM Adams 10311 Queen Charlotte Isl., BC FJ46728

Specimens only used for size determination of 4CL:

C. arizonica, Adams 9378, Pima Co., AZ; C. benthamii, Adams 8710,
Pachuca, MX; C. forbesii, Adams 9370, San Diego Co., CA; C. glabra
Adams 9389, Gila Co., AZ; C. goveniana, Adams 11544, Monterey Co.,
CA; C. guadalupensis, Adams 8417, Guadalupe Isl., MX, ex Berkeley
Bot. Garden; C. /usitanica, Adams 7071, cultivated, Bussaco, Portugal;
C. macnabiana, Adams 9359, Napa Co., CA; C. macrocarpa, Adams
11459, Crocker Grove, CA; C. montana, Adams 9660, Baja, MX; C.
nevadensis, Adams 9367, Kern Co., CA; C. sargentii, Adams 9348, San
Luis Obispo Co., CA; C. stephensonii, Adams 9376, San Diego Co.,
CA. Voucher specimens for Adams collections are deposited at
BAYLU. Bartel specimens are held in his personal herbarium.

One gram (fresh weight) of the foliage was placed in 20 g of
activated silica gel and transported to the lab, thence stored at -20° C
until the DNA was extracted. DNA was extracted from juniper leaves
by use of a Qiagen mini-plant kit as per manufacturer's instructions.

Amplification and sequencing

ITS (nrDNA), 4CL and tmC-trnD amplifications were
performed in 30 pl reactions using 6 ng of genomic DNA, 1.5 units
Epi-Centre Fail-Safe Taq polymerase, 15 ul 2x buffer E or K (final
concentration: 50 mM KCl, 50 mM Tris-HCl (pH 8.3), 200 uM each
dNTP, plus Epi-Centre proprietary enhancers with 1.5 - 3.5 mM MgCl,
according to the buffer used) 1.8 uM each primer.

Gene __ Primers 2x buffer annealing program size bp
nrITS ITSA/ITSB K 50°C (94-50x30) 1077-1105

4CL 4CL49F/4CL814R G 55°C (94-55x30) 746-823
CnABI3, CnABII1F/357R D S55C = (94-55-x30) 1020-1108

petN _petN5F/psbM111R_E 50°C __(94-50x30) 807-854

Primers (5'-3'):
ITS: ITSA = GGA AGG AGA AGT CGT AAC AAG G;

Phytologia (April 2009) 91(1) 169

Mss = CTT TTC CTC CGC ITA TTG ATA TG,
ITSA and ITSB primers from Blattner (1999).

4CL:4CL49F AAAGAGCTCATCAAATACAA

4CL814R GAAGAGCTTCCAGCTCAG
4CL primers are from conserved sequences in exon 2 and exon 3 of
Thuja plicata (EU183418, EU183417) and Thujopsis dolabrata
(EU 1834232) and span intron 2.

CnABI3: CnABI11F AACAATAAGAGCAGGATGTA
CnABI357R CCAGTTTTGGTATCAGAGTA
Addition internal primers utilized:
CnABhint533R CAATATTATCACGCATTTG
CnABhint541R CACAGGAGCAATATTATCAC
CnABhint741R TTACTTGAAACAATCTATTTATGT
CnABI3 primers are from sequences in exon 4 and exon 5 of
Chamaecyparis nootkatensis (AJ131113) and span intron 4.

petN - psbM:

petNSF: AAC GAA GCG AAA ATC AAT CA

psbM111R: AAA GAG AGG GAT TCG TAT GGA
petN and psbM primers were based on conserved sequences from
Juniperus species.

The following PCR conditions were used: MJ Research
Programmable Thermal Cycler, 30 cycles, 94°C (1 min.), 50°C or 57°C
(2 min.), 72°C (2 min.), with a final step of 72°C (5 min.). The PCR
reaction was subjected to purification by agarose gel electrophoresis
(1.5% agarose, 70 v, 55 min.). In each case, the band was excised and
purified using a Qiagen QIAquick gel extraction kit. The gel purified
DNA band with the appropriate primer was sent to McLab Inc. for
sequencing. Sequences for both strands were edited and a consensus
sequence was produced using Chromas, version 2.31 (Technelysium
Piy . Ltd.). Alignments were made using MAFFT

(http://align.bmr.kyushu-u.ac.jp/mafft/) and then manually corrected
and then re-analyzed using NJ with 1000 bootstrap replications

(http://align.bmr.kyushu-u.ac.jp/mafft/).

170 Phytologia (April 2009) 91(1)

We included Thuja and Thujopsis as outgroup taxa in the
analyses following the phylogenies of Gadek et al. (2000) and Little et
al. (2004).

RESULTS AND DISCUSSION

The overall sequencing efforts are shown in table 1. The
number of informative sites and the percent yield varied from largest in
nrDNA(ITS) to smallest in petN-psbM. Clearly, nrDNA(ITS) yielded
both the most informative sites and the greatest yield for the effort. The
single (or low) copy nuclear genes yielded lots of information, being
single genes, are difficult to amplify in amounts for preparative yields.
The cp DNA (petN-psbM) is multiple copy and very easy to amplify,
but the number and yield of informative sites 1s somewhat smaller.

Table 1. Summary of sequencing results. # of variable and # of
informative sites are within the in-group (excluding T. dolabrata and
Th. plicata). % yield of informative sites (% yield) = 100 x #
informative / minimum range observed.

gene range, bp _# variable _# informative % yield
nrDNA(UITS) 1077-1105 198 158 14.7%
4CL 746-823 124 79 10.6
CnABI3 1020-1108 137 83 8.1
petN-psbM 807-854 84 57 Dell

Sequencing the nrDNA (ITS region) resulted in 1077 to 1105
bp of sequence data. The ITS tree (Fig. 2) is similar to that of Little
(2006, Fig. 1, upper right, above), in that the cypresses from the Eastern
and Western Hemispheres are 100% supported as distinct clades. There
is some support (75%) for the clade of C. nootkatensis - X.
vietnamensis as reported by Little (2006, 61%, Fig. 1 above). The C.
nootkatensis - X. vietnamensis, clade is allied with the Western
Hemisphere cypresses using the ITS data (Fig. 2).

Sequencing of the 4-coumarate: CoA ligase intron 2 (4CL)
region resulted 746 - 823 bp of sequence data. Examination of the NJ
tree reveals four groups (fig. 3) as found with the nrDNA(ITS) data
(Fig. 2). The 4CL tree shows a weak association (34%) between C.

Phytologia (April 2009) 91(1) 171

pygmaea

nrDNA(ITS)

158 inf. nuc. abramsiana
1077-1105 bp

NJ phylogram

bakeri
C. nootkatensis
X. vietnamensis
J. saltillensis
100
J. monosperma

J. virginiana

C. dupreziana

92
C. atlantica

C. sempervirens

T. dolabrata

Th. plicata

Figure 2. NJ phylogram based on nrDNA(ITS). Numbers below
branches are bootstrap probabilities (1000 reps). Eastern Hemisphere
cypresses are in the cross-hatched box and Western Hemisphere
cypresses are in the shaded box.

L72 Phytologia (April 2009) 91(1)

C. atlantica

4CL

4-coumarate: CoA Ligase 43
79 inf. nuc. C. sempervirens

746-823 bp
C. dupreziana

NJ phylogram

C. nootkatensis

X. vietnamensis

J. saltillensis
98
J. monticola
J. virginiana
pygmaea
abramsiana
bakeri

T. dolabrata

Th. plicata

Figure 3. NJ phylogram utilizing sequences from intron 2 of 4-
coumarate: CoA ligase (4CL).

Phytologia (April 2009) 91(1) i723

nootkatensis-X. vietnamensis and the Eastern Hemisphere cypresses,
but again provides substantial support (99%) for the Western
Hemisphere cypress clade.

The three Western Hemisphere cypresses (C. abramsiana, C.
bakeri and C. pygmaea) each had a unique 46 bp insert giving them a
4CL length of 817 bp, in contrast, all other taxa that had shorter
sequences. A survey of all the other Western Hemisphere cypresses (C.
arizonica, C. benthamii, C. forbesii, C. glabra, C. goveniana, C.
guadalupensis, C. lusitanica, C. macnabiana, C. macrocarpa, C.
montana, C. nevadensis, C. sargentii, C. stephensonii) revealed that the
length is nearly constant at 817bp, indicating that all these taxa share
the 46bp insert.

Sequencing of the CnABI3 intron 4 region revealed several
large indels in this data set. The NJ phylogram based on CnABI3
sequence data again shows (Fig. 4) the separate clades of the Eastern
and Western Hemisphere cypresses. However, C. nootkatensis and X.
vietnamensis do not form a clade but are well supported as species.
The CnABI3 gene sequence supports the contention of Debreczy et al.
(2009) that C. nootkatensis and X. vietnamensis are monotypic genera,
since the former forms a strongly supported clade with the Western
Hemisphere cypresses (99%).

It is interesting to note that X. vietnamensis, C. atlantica, C.
dupreziana and C. sempervirens all share a unique 47 bp deletion.

Sequencing petN-psbM of cpDNA resulted lengths ranged
from 807 to 854 bp, except for 7. dolabrata that had only 511 bp. The
NJ phylogram (Fig. 5) again shows strong support for separate clades
for the Eastern and Western Hemisphere cypresses. Overall, the tree is
similar to the cpDNA tree of Little (2006) based on combined
sequences from matK, rbcL and trnL (Fig. 1, upper left), but the greater
amount of sequence data in Little’s tree provides very strong support
for the monophyly of the Western Hemisphere cypress lineage (100%),
while C. nootkatensis and X. vietnamensis are not resolved from the
Western Hemisphere cypresses in our analysis (Fig. 5). However,
again, the Eastern and Western Hemisphere cypresses are in well-
supported clades (Fig. 5).

174

ABI3

abscisic acid-insensitive 3
83 inf. nuc.

1020-1108 bp

NJ phylogram

Phytologia (April 2009) 91(1)

pygmaea
bakeri
abramsiana

C. nootkatensis

X. vietnamensis

J. saltillensis
J. monticola
J. virginiana

C. atlantica

99
C. sempervirens

C. dupreziana

T. dolabrata

Th. plicata

Figure 4. NJ phylogram based on ABI3 intron 4 sequences.

Phytologia (April 2009) 91(1) 175

petN-psbM abramsiana

57 inf. nuc.
807-854 bp PYSBCS

NJ phylogram bakeri

C. nootkatensis
X. vietnamensis
C. atlantica
C. dupreziana
C. sempervirens
J. saltillensis
J. monticola
J. virginiana
T. dolabrata

Th. plicata

Figure 5. NJ phylogram based on petN - psbM sequences of cp DNA.

176 Phytologia (April 2009) 91(1)

An analysis based on combined sequences (nrDNA(ITS), 4CL,
CnABI3, petN-psbM) yielding 377 phylogenetically informative
nucleotides. The NJ phylogram (Fig. 6) has 100% support for the 7.
dolabrata - Th. plicata, Western Hemisphere cypresses, Eastern
Hemisphere cypresses, and Juniperus clades. It also provides 100%
support for the grouping of C. nootkatensis and X. vietnamensis with
the Western Hemisphere cypresses, and is consistent with the proposal
by Debreczy et al. (2009) to treat these taxa as monotypic genera.

The separation of C. nootkatensis and X. vietnamensis is
consistent with several morphological characters distinguishing the
two: both needle-like juvenile leaves and scale-like adult leaves occur
on the mature plant in only the latter, the seed coat has minute warty
resin pustules in only the latter, and there is a short but quite distinct
resin-filled columella at the center of the mature and open seed cone in
only the former (Debreczy et al., 2009). Callitropsis nootkatensis and
similar extinct forms also have a substantial fossil record dating back to
at least 50 MYA in western North America (Edwards, 1983), which
may serve to provide a minimum time depth for the split between this
group and the Western Hemisphere cypress lineage.

Our results are consistent with those of Little (2006) in
providing further support for a distinct lineage of Western Hemisphere
cypresses quite separate from the Eastern Hemisphere cypresses and
most closely related to C. nootkatensis and X. vietnamensis. The
Western Hemisphere cypresses differ significantly in cone morphology
from the latter two species, notably in having cones with many more
seeds (typically 5-20 per cone scale and 60-150 per cone versus 2-4 per
cone scale and < 15 per cone), woodier and larger peltate cone scales,
and cotyledons, with few exceptions, 3-5 in number versus 2. Thus,
rather than following Little (2006), who included the Western
Hemisphere cypresses plus C. nootkatensis and X. vietnamensis in an
expanded genus Callitropsis, we recognize a new genus including only
the Western Hemisphere cypress lineage.

The traditional approach of including the Eastern Hemisphere
and Western Hemisphere cypress lineages in a genus to the exclusion of

Phytologia (April 2009) 91(1) 177

ar
Combined Molecular ike ints

377 inf. nuc.
3652-3883 bp pygmaea

NJ phylogram baker

C. nootkatensis

X. vietnamensis

J. monticola

J. saltillensis

J. virginiana

C. atlantica

C. semipervirens

C. dupreziana

T. dolabrata

Th. plicata

Figure 6. NJ phylogram based on combined sequences (nrDNA(ITS),
4CL, CnABI3, petN-psbM).

178 Phytologia (April 2009) 91(1)

Callitropsis, Xanthocyparis and Juniperus would run contrary to the
very likely phylogenetic relationships in the group supported by
multiple lines of molecular phylogenetic data, which indicate that C.
nootkatensis and X. vietnamensis rather than the Eastern Hemisphere
cypresses are the closest relatives of the Western Hemisphere cypresses
(Figs. 1, 6). We believe that the possible alternative approach of
including the entire clade of cypresses, junipers, Xanthocyparis and
Callitropsis in a single genus would be unduly disruptive to the
nomenclature of horticulturally important taxa, particularly if
Cupressus is given nomenclatural priority over Juniperus (which would
require 67 new combinations at the species level; Adams, 2008), and
would also tend to obscure rather than elucidate the morphological
groupings and major evolutionary lineages in the group. We
provisionally recognize 16 species as distinct for purposes of providing
new species combinations, following the monographic treatment of
Wolf (1948) and the phylogenetic results of Little (2006).

The new genus is cryptic in its macromorphology, being
similar to Cupressus stricto sensu in its general appearance and cone
morphology, but is very distinct in molecular phylogenetic analyses
from multiple genes and two genomes. In morphology, it is most
evidently distinguished from the majority of species of Cupressus
stricto sensu in its greater number of cotyledons (3-5), and is
distinguished from any taxa of Eastern Hemisphere cypresses that may
have parallelisms for this character (C. torulosa of Asia has 3-5
cotyledons according to Camus, 1914) by a combination of branchlet
characters as described below. Cupressus torulosa and all other native
Eurasian and African species of the genus are unequivocally placed in
the Eastern Hemisphere clade in the molecular phylogenetic analyses of
Little (2006). Recognition of new genera as new sources of
phylogenetic information emerge to support them as _ distinct
evolutionary units has a long tradition, as witness the segregation of
multiple genera of Cupressaceae with similar cone morphology from
the classical genus Libocedrus. These segregate genera are now widely
recognized (Farjon, 1998, 2005) and are well supported by recent
molecular studies (Gadek et al., 2000).

Phytologia (April 2009) 91(1) 179

TAXONOMIC TREATMENT

Hesperocyparis Bartel & R. A. Price, gen. nov.—
TYPE: Hesperocyparis macrocarpa (Hartw. ex Gordon)
Bartel.

Differt a Callitropse and Xanthocypare cotyledonibus 3-—S (vs.
2), squamis strobilis paribus 3—6 (vs. 2—3) peltatis non dense incrassatis
(vs. basifixis non dense incrassatis), et seminibus per strobilum
generaliter 60-150 (vs. paucioribus quam 15). Differt a Cupresso
cotyledonibus 3—5 (vs. plerumque 2), testa generaliter glauco (vs. non
glauco), ordinibus ultimis duobus segmentis caulinis in fasciculis 3-
dimensionalibus, segmentis ultimis caulibus in sectione transversali non
complanatis, et foliis monomorphis segmentorum caulinorum
ultimorum (vs. ordinibus ultimis duobus segmentis caulinis in
asperginibus 2-dimensionalibus aut segmentis caulinis ultimis in
sectione transversali complanatis et foliis dimorphis segmentorum
caulinorum ultimorum). Plantae Hemisphaerii Occidentalis.

Hesperocyparis differs from Callitropsis and Xanthocyparis in
its cotyledons 3-5 (vs 2), seed cone scales in 3-6 pairs (vs 2-3 pairs),
peltate and heavily thickened (vs basifixed and not heavily thickened),
and seeds per cone generally 60-150 (vs < 15). Hesperocyparis differs
from Cupressus in its cotyledons 3-5 (vs usually 2), seed coat generally
+ glaucous (vs not glaucous), usually ultimate 2 orders of branch
segments in 3-dimensional clusters, ultimate branch segments not
flattened in cross section, and ultimate branch segments leaves
monomorphic (vs usually ultimate 2 orders of branch segments in 2-
dimensional sprays, or ultimate branch segments flattened in cross
section and ultimate branch segments leaves dimorphic). Plants of the
Western Hemisphere.

Shrub or tree to (<1-)4-35(-40) m, multi- to generally single-
trunked, monoecious, evergreen. Bark on trunk fibrous or leathery and
smooth, exfoliating in fibrous strips or irregular-shaped plates, gray to
brown to cherry-brown. Branch segments (stems and overlapping
leaves) terete to quadrangular, ultimate and penultimate branch
segments generally in 3-dimensional clusters or rarely in 2-dimensional
flattened sprays. Leaves of juvenile plants awl- to needle-like,

180 Phytologia (April 2009) 91(1)

decussate or in whorls of 3; of adult plants decussate, scale-like,
appressed, overlapping, generally monomorphic, minutely denticulate
or rarely entire, often with a dorsal resin gland, leaves on vigorously
growing shoots more elongate and acute-tipped. Pollen cones, terminal
on separate ultimate branch segments, sub-spheric to elliptic-ovoid to
cylindrical, terete to quadrangular, 2.0-6.5 mm long, 1.3-3.0 mm wide,
yellow-green; microsporophylls decussate in 3-10 pairs, 3-6(10)
sporangia in an irregular row per microsporophyll. Seed cones 10-50
mm long, more or less woody, nearly spheric to widely cylindric,
maturing in the second year, generally remaining closed at maturity and
opening after many years or in response to fire, abscising after opening
or after many additional years; scales decussate in (2-)3-6 pairs,
thickened, peltate, abutting, shield- or wedge-shaped, boss generally >1
mm (especially prior to maturity), pointed, base level with or rising
from edge. Seeds many per scale (generally 5-20) per cone, flattened,
ovate to lenticular, irregularly faceted due to close packing; seed wings,
2, membranous, narrow, seed body light tan to red brown to brown to
dark brown to black, generally glaucous, generally warty with minute
resin pustules in the seed coat; cotyledons (2-)3-5(-6), linear, slightly
ridged, bluntly pointed at apex. Chromosome number, 2n = 22(23,24).

Hesperocyparis abramsiana (C. B. Wolf) Bartel, comb. nov.
Cupressus abramsiana C. B. Wolf, Aliso 1: 215. 1948.
Cupressus goveniana Gordon var. abramsiana (C. B. Wolf)
Little, Phytologia 20: 435. 1970. Cupressus goveniana
Gordon subsp. abramsiana (C. B. Wolf) A. E. Murray, Kalmia
12: 19. 1982. Callitropsis abramsiana (C. B. Wolf) D. P.
Little, Syst. Bot. 31: 473. 2006.

Hesperocyparis arizonica (Greene) Bartel, comb. nov. Cupressus
arizonica Greene, Bull. Torrey Bot. Club 9: 64. 1882.
Cupressus benthamii Endl. var. arizonica (Greene) Mast., J.
Linn. Soc. Bot. 31: 340. 1896. Callitropsis arizonica (Greene)
D. P. Little, Syst. Bot. 31: 473. 2006.

Hesperocyparis bakeri (Jeps.) Bartel, comb. noy. Cupressus bakeri
Jeps., Fl. Calif. 1: 61. 1909. Cupressus macnabiana A.
Murray bis var. bakeri (Jeps.) Jeps., Man. Fl. Pl. Calif. 58.

Phytologia (April 2009) 91(1) 181

1923. Callitropsis bakeri (Jeps.) D. P. Little, Syst. Bot. 31:
473. 2006.

Hesperocyparis benthamii (Endl.) Bartel, comb. nov. Cupressus
benthamii Endl., Syn. Conif. 59. 1847. Cupressus lusitanica
Mill. var. benthamii (Endl.) Carriere, Traité Gén. Conif., ed. 2,
155. 1867. Cupressus lusitanica Mill. subsp. benthamii
(Endl.) Franco, Agros (Lisbon) 28: 24. 1945. Callitropsis
benthamii (Endl.) D. P. Little, Syst. Bot. 31: 473. 2006.

Hesperocyparis forbesii (Jeps.) Bartel, comb. nov. Cupressus forbesii
Jeps., Madrofio 1: 75. 1922. Cupressus guadalupensis S.
Watson var. forbesii (Jeps.) Little, Phytologia 20: 435. 1970.
Cupressus guadalupensis S. Watson subsp. forbesii (Jeps.) R.
M. Beauch., Aliso 9: 191. 1978. Callitropsis forbesii (Jeps.)
D. P. Little, Syst. Bot. 31: 473. 2006.

Hesperocyparis glabra (Sudw.) Bartel, comb. nov. Cupressus glabra
Sudw., Amer. Forest. 16: 88. 1910. Cupressus arizonica
Greene var. glabra (Sudw.) Little, Madrofio 18: 162. 1966.
Cupressus arizonica Greene subsp. glabra (Sudw.) A. E.
Murray, Kalmia 12: 19. 1982. Callitropsis glabra (Sudw.) D.
P. Little, Syst. Bot. 31: 473. 2006.

Hesperocyparis goveniana (Gordon) Bartel, comb. nov. Cupressus
goveniana Gordon, J. Hort. Soc. London 4: 295. 1849.
Callitropsis goveniana (Gordon) D. P. Little, Syst. Bot. 31:
473. 2006.

Hesperocyparis guadalupensis (S. Watson) Bartel, comb. nov.
Cupressus guadalupensis S. Watson, Proc. Amer. Acad. Arts
14: 300. 1879. Cupressus macrocarpa_ Hartw. var.
guadalupensis (S. Watson) Mast., Gard. Chron., Ser. 3 18: 62.
1895. Callitropsis guadalupensis (S. Watson) D. P. Little,
Syst. Bot. 31: 473. 2006.

Hesperocyparis lusitanica (Mill.) Bartel, comb. nov. Cupressus
lusitanica Muill., Gard. Dict., ed. 8. Cupressus no. 3. 1768.

182 Phytologia (April 2009) 91(1)

Callitropsis lusitanica (Mill.) D. P. Little, Syst. Bot. 31: 474.
2006.

Hesperocyparis macnabiana (A. Murray bis) Bartel, comb. nov.
Cupressus macnabiana A. Murray bis, Edinburgh New Philos.
J. ser. 2, 1: 293. 1855. Callitropsis macnabiana (A. Murray
bis) D. P. Little, Syst. Bot. 31: 474. 2006.

Hesperocyparis macrocarpa (Hartw. ex Gordon) Bartel, comb. nov.
Cupressus macrocarpa Hartw. ex Gordon, J. Hort. Soc.
London 2: 187. 1847. Callitropsis macrocarpa (Hartw.) D. P.
Little, Syst. Bot. 31: 474. 2006.

Hesperocyparis montana (Wiggins) Bartel, comb. nov. Cupressus
montana Wiggins, Contr. Dudley Herb. 1: 161. 1933.
Cupressus arizonica Greene var. montana (Wiggins) Little,
Madrofio 18: 163. 1966. Cupressus arizonica Greene subsp.
montana (Wiggins) A. E. Murray, Kalmia 15: 11. 1985.
Callitropsis montana (Wiggins) D. P. Little, Syst. Bot. 31:
474. 2006.

Hesperocyparis nevadensis (Abrams) Bartel, comb. nov. Cupressus
nevadensis Abrams, Torreya 19: 92. 1919. Cupressus
macnabiana A. Murray bis var. nevadensis Abrams (Abrams),
Ill. Fl. Pacific States 1: 73. 1923. Cupressus arizonica Greene
var. nevadensis (Abrams) Little, Madrofio 18: 164. 1966.
Cupressus arizonica Greene subsp. nevadensis (Abrams) A. E.
Murray, Kalmia 12: 19. 1982. Callitropsis nevadensis
(Abrams) D. P. Little, Syst. Bot. 31: 474. 2006.

Hesperocyparis pygmaea (Lemmon) Bartel, comb. nov. Cupressus
goveniana Gordon var. “pigmaea” Lemmon, Handb. W.
Amer. Cone-bearers. ed. 3, 77. 1895. Cupressus pygmaea
(Lemmon) Sarg., Bot. Gaz. (Crawfordsville) 31: 239. 1901.
Cupressus goveniana Gordon subsp. pygmaea (Lemmon) A.
Camus, [Les Cyprés] Encycl. Econ. Sylvicult. 2: 50. 1914.
Callitropsis pigmaea (Lemmon) D. P. Little, Syst. Bot. 31:
474. 2006.

Phytologia (April 2009) 91(1) 183

Hesperocyparis sargentii (Jeps.) Bartel, comb. nov. Cupressus
sargentii Jeps., Fl. Calif. 1: 61. 1909. Cupressus goveniana
Gordon var. sargentii (Jeps.) A. Henry, in Elwes & A. Henry,
Trees Great Britain 1173. 1910. Callitropsis sargentii (Jeps.)
D. P. Little, Syst. Bot. 31: 474. 2006.

Hesperocyparis stephensonii (Jeps.) Bartel, comb. nov. Cupressus
stephensonii C. B. Wolf, Aliso 1: 125. 1948. Cupressus
arizonica Greene var. stephensonii (C. B. Wolf) Little,
Madronio 18: 164. 1966. Cupressus arizonica Greene subsp.
stephensonii (C. B. Wolf) A. E. Murray, Kalmia 12: 19. 1982.
Callitropsis stephensonii (C. B. Wolf) D. P. Little, Syst. Bot.
31: 474. 2006.

ACKNOWLEDGEMENTS

This research supported in part with funds from U. S. Fish and
Wildlife Service, Grant 814307J011. The findings and conclusions in
this article are those of the authors and do not necessarily represent the
views of the U.S. Fish and Wildlife Service. Thanks to Tonya Yanke
for lab assistance. Thanks to Andrea Schwarzbach and Billie Turner
for manuscript reviews.

LITERATURE CITED

Adams, R. P. 2007. Juniperus maritima, the seaside juniper, a new
species from Puget Sound, North America. Phytologia 89: 263-
283.

Adams, R. P. 2008. The junipers of the world: The genus Juniperus,
2nd Ed., Trafford Publ., Victoria, BC.

Adams, R. P., A. E. Schwarzbach, J. A. Morris and S. Gonzalez
Elizondo. 2007. Juniperus compacta, a new species from Mexico
(Cupressaceae). Phytologia 89: 361-369.

Averyonov, L. V., T. H. Nguyén, D. K. Harder and K. L. Phan. 2002.
The history of discovery and natural habitats of Xanthocyparis
vietnamensis (Cupressaceae). Turczaninowia 5: 31-39.

Brummitt, R. K. 2007. Report on nomenclature committee for vascular
plants: Taxon 59: 1289-1296.

Camus, A. 1914. Les Cyprés. Encyclopédie économique de
Sylviculture 2 Paul Lechevalier, Paris.

184 Phytologia (April 2009) 91(1)

Cukovic, D., J. Ehlting, J. A. VanZiffle and C. J. Douglas. 2001.
Structure and evolution of 4-coumarate: Coenzyme A Ligase
(4CL) gene families. Biol. Chem. 382: 645-654.

Debreczy, Z., K. Musial, R. A. Price and I. Racz. 2009. Relationships
and nomenclatural status of the Nootka cypress (Callitropsis
nootkatensis, Cupressaceae) Phytologia 91(1):140-159

Edwards, S. W. 1983. Cenozoic history of Alaskan and Port Orford
Chamaecyparis cedars. Ph.D. Dissertation, University of
California, Berkeley.

Farjon, A. 1993. Nomenclature of the Mexican cypress or “cedar of
Goa,” Cupressus lusitanica Mill. (Cupressaceae). Taxon 42: 81-
84.

Farjon, A., 1998. World checklist and bibliography of conifers. Royal
Bot. Gard., Kew, London.

Farjon, A. 2005. A monograph of Cupressaceae and Sciadopitys.
London: Royal Botanic Gardens, Kew.

Farjon, A. 2007. In defence of a conifer taxonomy which recognises
evolution. Taxon 56: 639-641.

Farjon, A., T. H. Nguyén, D. K. Harder, K. L. Phan and L. Averyanov.
2002. A new genus and species in Cupressaceae (Coniferales) from
northern Vietnam, Xanthocyparis vietnamensis. Novon 12: 179-
189.

Gadek, P. A., D. L. Alpers, M. M. Heslewood and C. J. Quinn. 2000.
Relationships within Cupressaceae (sensu lato): a combined
morphological and molecular approach. Am. J. Bot. 87: 1044-
1057.

Hamberger, B. and K. Hahlbrock. 2004. The 4-coumarate: CoA ligase
family in Arabidopsis thaliana comprises one rare, sinapate-
activating and three commonly occurring isoenzymes. PNAS 101:
2209-2214.

Lazarova, G., Y. Zeng and A. R. Kermode. 2001. Cloning and
expression of an ABSCISIC ACID-INSENSITIVE 3(abi3) gene
homologue from yellow-cedar (Chamaecyparis nootkatensis). J.
Exp. Bot. 53: 1219-1221.

Little, E. L., 1970. Names of new world cypresses (Cupressus)
Phytologia 20 :429-445.

Little, D. P. 2006. Evolution and circumscription of the true cypresses
(Cupressaceae: Cupressus) Syst. Bot. 31: 461-480.

Phytologia (April 2009) 91(1) 185

Little, D. P., A. E. Schwarzbach, R. P. Adams and C-F. Hsieh. 2004.
The circumscription and phylogenetic relationships of Callitropsis
and the newly described genus Xanthocyparis (Cupressaceae).
Amer. J. Bot. 91: 1872-1881.

Mill, R. R. and A. Farjon. 2006. Proposal to conserve the name
Xanthocyparis against Callitropsis Oerst. (Cupressaceae). Taxon
50° 229-231.

Peng, D. and X-Q. Wang. 2008. Reticulate evolution in Thuja inferred
from multiple gene sequences: Implications for the study of
biogeographical disjunction between eastern Asia and North
America. Molec. Phylogenetics Evol. 47: 1190-1202.

Rushforth, K. 2007. Notes on the Cupressaceae in Vietnam. J. Biol.
(Vietnam) 29(3): 32-35.

Silba, J. 1983. Addendum to revised generic concepts of Cupressus L.
(Cupressaceae). Phytologia 52: 349-361.

Silba, J. 1994. The trans—Pacific relationship of Cupressus in India and
North America. J. Int. Conifer Preserv. Soc. 1(1): 1-28.

Silba, J. 1998. A monograph of the genus Cupressus L. J. Int. Conifer
Preserv. Soc. 5(2): 1-98.

Silba, J. 2005. A monograph of the genus Cupressus L. in the twenty-
first century. J. Int. Conifer Preserv. Soc. 12(2): 31-103.

Silba, J. 2006. The chronological history and taxonomic variation of the
genus Cupressus (Cupressaceae) in India. Acta Bot. Yunnanica
28(5): 469-470.

Wolf, C. B. 1948. Taxonomic and distributional studies of the New
World cypresses. Aliso 1: 1-250.

Xiang, Q. and J. Li. 2005. Derivation of Xanthocyparis and Juniperus
from within Cupressus: evidence from sequences of nrDNA
internal transcribed spacer region. Harvard Pap. Bot. 9: 375-382

186 Phytologia (April 2009) 91(1)

NEW NAMES IN CHAMAESARACHA (SOLANACEAE)

James Henrickson
Plant Resources Center
University of Texas, Austin 78712

ABSTRACT

Two new names are proposed for Chamaesaracha: C. arida
Henrickson, [C. coronopus auct. non (Moric. ex Dunal) A. Gray] and
C. texensis Henrickson [C. conoides auct. non (Moric. ex Dunal) Britt.]
Chamaesaracha villosa Rydb. is used for the taxon inclusive of C.
crenata Rydb. Phytologia 91(1):186-188 (April, 2009).

KEY WORDS: Chamaesaracha arida, C. texensis, Solanaceae.

A new name is needed for a distinct taxon that was included
within Chamaesaracha coronopus (Moric. ex Dunal) A. Gray by
Averett (1973).

CHAMAESARACHA ARIDA Henrickson, sp. nov. TYPE: U.S.A.
New Mexico: Santa Fe Co., ca. 19 mi. s. of Santa Fe, N.M. on Hwy. 85,
15 Jul 1968, J.-E. Averett & A.S. Tomb 339 (holotype TEX!).

Folia caules pedicellique subglabri pilis dispersis basibus latis distaliter
furcatis vel ramosis 0.1-0.3 mm longis, segmentis pilorum superiorum
brevis latis obtusisque, raro pilis gradatim angustatis simplicibus vel
furcatis ad 1.5 mm longis, foliis linearis vel lineari-lanceolatis vel
lineari oblanceolatis marginibus undulatis et dentatis vel pinnati-lobatis.

Leaves, stems, pedicels subglabrous, with scattered, broad-based,
distally forked to branched hairs 0.1-0.3 mm long, the upper hair
branches short, blunt, rarely with tapering, simple or distally branched

Phytologia (April 2009) 91(1) 187

hairs; leaves linear to linear-lanceolate, linear-oblanceolate, the margins
undulate, toothed or pinnately lobed.

Study of lectotype and syntype specimens of C. coniodes
(Moric. ex Dunal) Britt. at Geneva (G), show that the taxon is
characterized by a dense low vestiture of forked-branched hairs.
Averett’s (1973) and Rydberg’s (1896) usage of the name for a stipitate
glandular species is incorrect and a new name is provided herein for the
stiptiate glandular species.

CHAMAESARACHA TEXENSIS Henrickson, sp. nov.
[Chamaesachara coniodes auct. non (Moric. ex Dunal) Britt.]. Type:
U.S.A. Texas: Kinney Co., open rocky soil near the Nueces River, Hy.
334, 17 Apr 1957, D.S. Correll 15965 with R.C. Rollins & K. Chambers
(holotype LL!).

A Chamaesaracha sordida foliorum juniorum irregulatim dentato-
laceratis vel pinnatifidis lobatis integris vel dentatis (non dentatis
obtusis vel non profundis paucisque) et tetraploideis (n=24) non
diploideis (n=12) dignoscenda.

From Chamaesaracha sordida distinguished by the young leaves being
irregularly toothed-lacerate to pinnatifid, with entire to toothed lobes
(not entire to bluntly or shallowly few toothed) and tetraploid (n=24)
(not diploid n=12).

I herein combine C. villosa Rydb. with C. crenata Rydb., and
use the name C. villosa Rydb. for the inclusive species. Both were
published on the same page in Mem. Torr. Bot. Club. 4:368. 1896.

ACKNOWLEDGEMENTS

Latin was provided by Paul Fryxell. The manuscript was
reviewed by T. Wendt and B. Simpson of TEX-LL.

188 Phytologia (April 2009) 91(1)

LITERATURE CITED

Averett, J. E. 1973. Biosystematic study of Chamaesaracha
(Solanaceae). Rhodora 75: 325-365.

Rydberg, P. A. 1896. North American species of Physalis and related
genera. Mem. Torrey Bot Club 4; 297-374.

LOL HA

PHYTOLOGIA is published three times a year. Annual
domestic individual subscription (3 issues): $30.00. Annual domestic
institutional subscription (3 issues): $90.00. Foreign individual
subscription $50, Foreign institutional subscriptions $110, send
subscription checks to Robert P. Adams, Mgr. Ed., P. O. Box 727,
Gruver, TX 79040, USA. Please make checks payable to Phytologia.

INFORMATION FOR AUTHORS

Articles from botanical systematics and ecology, including
biographical sketches, critical reviews, and summaries of literature will
be considered for publication in PHYTOLOGIA. Authors should arrange
for two workers in the appropriate field to review the manuscript before
submission. Copies of reviews should be forwarded to the editor with
the manuscript. Additional review may occur for articles proposing
significant nomenclatural changes and or revisions to established taxa.
Effort will be made to locate a reviewer for author(s) if he/she desires.
Language of manuscripts is English. Format of articles should follow
past issues of PHYTOLOGIA (preferably single spaced and Times New
Roman in 10 point font. Please visit www.phytologia.org for detailed
computer file instructions.

Cost of publication is currently $15.00 US per final page for
publication without reprints. PDF files of papers will be made available
to authors at www.phytologia.org. Page charges are due with
manuscripts. No extra charges are made for line drawings or grey scale
photos. Extra fees will be charged for color photos, the charge will be
determined on an individual basis.

All manuscripts should be submitted digitally, either by
3.5"disk, CD, DVD or email to Robert_Adams@baylor.edu.
or, if mailed,
Phytologia, Dr. Robert Adams
P. O. Box 727
Gruver, TX 79040, USA

ibrar

|

¥

862

New book!

The Junipers of the World: The
Genus Juniperus, 2nd Ed.
Robert P. Adams. (2008).
Trafford Publ., Victoria, BC.

Available from:
Trafford.com or Amazon.com

see Www. juniperus.org for details.

Volumes 12 and 13 of Phytologia Memoirs
series are still available. cae eine

B. L. Turner. The Comps of Mexico: Chapter 8:
Liabeae and Vernonieae. Phytologia Memoirs
Vol. 12. 144 pgs. 2007 $25.

B. L. Turner and Tom Watson. Taxonomic
revision of Gaillardia (Asteraceae). Phytologia
Memoirs Vol. 13. 118 pgs. 2007. $25.

Available for $25 each. Order from Phytologia
(see address inside cover) or see
www.phytologia.org